Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
![Mutations
Adenosine triphosphate is an energy molecule found in cells and produced as a result of cellular respiration.
Many enzymes are required for cellular respiration to produce an ATP molecule. The following is an original DNA
segment from a sequence that codes for the production of an enzyme necessary for the production of ATP in
organisms:
Original DNA: TACAAGTTTAGTACGTATATGCCAACT
A mutation occurred during replication that resulted in the following change in the segment of DNA:
Mutated DNA: TACAAGTTTATGTACGTATATGCCAACT
1) Identify (circle the mutation in the mutated sequence) and name the type of mutation that occurred.
2) Evaluate the the significance of this mutation.
a. How does this mutation affect the production of ATP?
b. How will this mutation affect this organism cellular respiration process?](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F7bb4d942-dddd-4d62-9f4a-8e36ffa9ff75%2F5b3f7645-9b7f-4074-ad7d-7c72bdb1c166%2Ffs1j6r6_processed.jpeg&w=3840&q=75)
![Write the Word Problem
Below is a series of crosses. Your job is to turn the given test crosses into word problems and show the
completed Punnett square for each word problem.
Use these alleles for your word problems!
R = Round seed
r = wrinkled seed
"coverec
P = purple flowers
p= white flowers
ines the
T = tall plant
t = short plant
anism
1. TT x Tt
CA
2. Rr x rr
3. PPT x ppTt](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F7bb4d942-dddd-4d62-9f4a-8e36ffa9ff75%2F5b3f7645-9b7f-4074-ad7d-7c72bdb1c166%2Foaqmamt_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
# Here I have given solution of mutations only , please send next question related to genetics separately .
Mutation : It is a change that occurs in our DNA sequence either due to mistake when the DNA is copied or as the result of environmental factors such as UV light and cigarette smoke. Over a lifetime DNA can undergo changes or mutations in the sequence of bases A, C, G, T .
Through direct sequencing single base pair mutations can be identified.
Mutation given in the question is Insertion type means when a base is added to the sequence and in this given sequence Thymine (T ) is inserted .
Actually there are lots of mutations which occur like :
Point mutation , Substitution mutation, Inversion mutation, Insertion mutation, Deletion mutation etc.
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
![Human Anatomy & Physiology (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Human Anatomy & Physiology (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Molecular Biology of the Cell (Sixth Edition)](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
![Laboratory Manual For Human Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
![Inquiry Into Life (16th Edition)](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)