How does RhoGAM prevent HDN? A) it is an antigen that binds to and inactivates anti-Rh antibody from fetus B) it is an antigen that binds to and inactivated anti-Rh antibody from mother C) it is an antibody that binds to and inactivates Rh factor from mother D) it is an antibody that binds to and inactivates Rh factor from fetus
Q: What are some theories or causes of narcolepsy along with the the treatment or therapeutic methods…
A: Narcolepsy is derived from the greek words "narco," that means numbness, or stiffness, and "lepsy,"…
Q: discuss the practical use of colonial morphology and cellular morphology in the identification of…
A: Please follow step 2 for detailed explanation.
Q: what is the sun made of?
A: To explain: To explain about the sun and its composition
Q: 1. Which of the following statements is correct? A. Adrenal glands are inferior to the kidneys B.…
A: A tissue is a group of one or more types of cells an their intracellular substance that perform a…
Q: To determine: How chloroplasts generate a larger proton gradient across the thylakoid membrane than…
A: The photochemical and electron transport reactions of photosynthesis process occur at the thylakoid…
Q: Give the major factors that cause changes in the genotype and allele frequencies of a population…
A: Evolutionary mechanisms do not operate in isolation in natural populations. Conservation…
Q: A population has 700 individuals, 85 of genotype AA, 320 of genotype Aa and 295 of genotype aa. What…
A: The Hardy-Weinberg equation is expressed as: p2 + 2pq + q2 = 1 p is the frequency of the "A" allele…
Q: The image above represents a simple cladogram for the primate order, where the letters are nodes and…
A:
Q: Which of the following Does not describe the juxtaglomerular com Its granular cells produce rennin…
A: In kidney, juxtaglomerular compartment is the key regulator of the functions of each nephrone. It is…
Q: List two types of multifactorial inheritances and explain them.
A:
Q: The main products of the light dependent reactions are: O water and carbon dioxide ATP and NADPH O…
A: To determine: To determine the main products of the light dependent reactions
Q: The intracellular matrix differs from the extracellular matrix in that the latter is located A…
A: Q. The intracellular matrix differs from the extracellular matrix in that the latter is located A…
Q: In vertebrates, there exist a double circulation. What are these and explain each in the terms of…
A: Introduction The circulatory system pumps blood from the heart to the lungs to get oxygen, An…
Q: How can you protect yourself from diseases that can be acquired from the environment?
A: 1)Good hygiene: the most important way to prevent infectionsThe first line of defense is the control…
Q: THE MOST AGGRESSIVE IS DUST CONTAINING 1. silicon dioxide in the connected condition 2. silicon…
A: Introduction The respiratory system is a biological system in animals and plants that consists of…
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A:
Q: Why is bush encroachment a common characteristic between Sweet and the Sour veld, veld types whereas…
A: A veld which is also commonly known as veldt is large landscape that is open and flat. Perennial…
Q: How does natural increase, natural decrease, equilibrium affects or influence the population and…
A: Typically, population refers to the number of people in a certain place, such as a city or town,…
Q: QUESTIONS FOR RESEARCH AND PROBLEMS 1. Give the major factors that cause changes in the genotype and…
A: The complete set of genetic material in an organism is known as genotype. It can also be referred to…
Q: cells in the thyroid gland secrete calcitonin which -------calcium concentration decrease increase O…
A: Hormones are chemicals that essentially function as messengers of the body. These chemicals are…
Q: 8. Which of the following statements about oxytocin is correct? A. Dilation of cervix and baby…
A: Oxytocin is a hormone delivered by the pituitary organ that causes expanded expansion of the uterus…
Q: The gram negative unknown organism that is Enterobacter aerogenes? What kind of the shape of…
A: Enterobacter aerogenes is a proteobacteria which belongs to Enterobacteriales and family…
Q: Animal Diversity Second mouth Symmetrical animals Asymmetrical animals Spiny skin Radial symmetry…
A: These are term related to animal diversity.
Q: Metalloprotein linkages are most likely to be formed between: a.Two cysteines b.An arginine and a…
A: Metalloprotein linkages are most likely to be formed between?
Q: 1. Name the receptor indicated by the arrow labeled A. 2. What specific layer of the skin is…
A: 1. Meissner's corpuscle They contain a cutaneous nerve ending responsible for transmission of…
Q: Based on the milkfish dissection, describe the structure of skull and vertebral column design. How…
A: Answer :: Milkfish (Chanos chanos) is the only fish species that belongs to Family Chanidae which is…
Q: Energy is released reactants AG <0 products Time This graph shows an reaction. Gibbs Free Energy
A: This graph showing exothermic reaction.
Q: how an angiotensin converting enzyme inhibitor ACE such as captopril would effective as an…
A: Anti hypertensive means the drug causes the reduction in blood pressure. Normal blood pressure is…
Q: Create a table comprising example and features from Domain to common name. Create 1 table for each…
A: Taxonomy is the branch of science that deals with the name, description, and classification of all…
Q: Calculating the probability of two parents - each coming from a large family with a history of a…
A: Mendel uncovered the fundamental laws of heredity. His experiments demonstrated that the inheritance…
Q: Distinguish between monohybrid, dihybrid and test crosses. Maximum number of characters (including…
A: Difference between monohybrid and Dihybrid test cross are given below -
Q: To explain: The reason why the movement of H* ions is faster than Ca²* ions. Also how this speed…
A: Ions play a variety of roles in cellular functions such as electrical communication (Na+, K+, Ca2+),…
Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…
A: The process of synthesis of proteins from mRNA is called as translation while the process of…
Q: Question 5 Describe briefly the TWO distinct roles of the v-SNARE and t-SNARE proteins in vesicle…
A: Role of SNARE proteins in vesicle transport :-
Q: 4. Describe the process of alternation of generations using any plant phylum as an example. In your…
A: Introduction :- In plants and algae, the most common type of life cycle is generational alternation.…
Q: 417 ash Course Biology #7 - ATP & Respiration 1. Cellular respiration is how we derive energy from…
A: Respiration is the biochemical process in which the cells of an organism obtain energy by combining…
Q: NSWER THIS; Click Edit DNA and make a substitution mutation that changes the first base (C) in the…
A: The genome of a cell carries various genes that code for one or more proteins. The genes are coded…
Q: high temp can decrease the deamidation reaction true or false
A: Deamination occurs mostly in the liver, but it can also happen in the kidney. Deamination is…
Q: A/An ___ is one of the 13 linear polymers of tubulin subunits that forms a microtubule.
A: The cytoskeleton is made up primarily of microtubules. They are found in all eukaryotic cells and…
Q: pure-breeding yellow (Y) canaries crossed with pure breeding blue (y) canaries make green…
A: Inheritance is the process by which genetic information is passed on from parent to child.
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A: DNA contains the genetic information about the characteristics features of te organism present in…
Q: Examine the family pedigree. What is the probability that their next child will have dry air wax?…
A: Pedigree Pedigree is a chart or diagram that show the occurrence and appearance of any gene of…
Q: Use a cost–benefit approach to explain why females whose eggs are destroyed still remain with the…
A: Social animals often form long-lasting relationships with fellow group members, usually with…
Q: or each of the following genotypes how many gametes would be made? a. AaBb - b. AaBbCC - c.…
A:
Q: 1.Compare the structures of ATP to these nucleic acids: cAMP, dinucleotides, RNA, DNA. Your…
A: Nucleic acids include DNA and RNA. The DNA and RNA stand for deoxyribonucleic acid and ribonucleic…
Q: Something with a pH of 5 would be A) acidic B) alkaline C) neutral D) basic
A: Acidic and basic are two extremes that describe a chemical property chemicals. Mixing acids and…
Q: f your 16x concentrated stock solution contains 20g of Nacl per liter, how much Nacl would one liter…
A: Given:- Concentration of stock solution= 16X NaCl required per litre= 20g NaCl required for 1 litre…
Q: Dekaylen umber of human diseases result from chromosomal abnormalities. Individuals with cri du chat…
A: Cri-du-chat syndrome, often called 5p- (five p minus) syndrome, is a chromosomal disorder caused by…
Q: What is the principle behind a UV-Vis spectrophotometer, and what are its key components, and how…
A: UV-vis spectrophotometry or UV spectroscopy types of absorption spectroscopy or reflectance…
Q: GENERAL BIOLOGY 2 Q1 : How can plants reproduce naturally?? A. Using anthers B. Using cuttings C.…
A: plants reproduce naturally by Using runners.…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A person with type A+ blood gets a transfusion with type O- blood. What is most likely to happen to the recipient? A) The recipient's blood will agglutinate (clump) due to the presence of natural antibodies in the recipient's blood. B) Nothing because the donor's blood is compatible with the recipient's blood. C) The recipient's blood will agglutinate (clump) due to the presence of natural antigens on the recipient's blood cells.Even though instances of fetal, maternal ABO, incompatibility are common, severe hemolytic disease due to ABO incompatibility is rare. Which of the following best explains this difference? A) ABO incompatibility causes extensive extra medullary hematopoiesis B) antibodies against ABO antigens do not bind complement C) the maternal immune system is tolerant to ABO ANTIGENS D) most anti- A or anti- B antibodies are of IgM type and do not cross the placenta E) the presence of concurrent Rh incompatibility decreases the immunogenicity of erythrocytes41) For the successful development of a vaccine to be used against a pathogen, it is necessary that A) the surface antigens of the pathogen do not change. B) a rearrangement of the B cell receptor antibodies takes place. C) all of the surface antigens on the pathogen be identified. D) the pathogen has only one epitope. E) the MHC molecules are heterozygous. 42) In the human disease known as lupus, there is an immune reaction against a patient's own DNA from broken or dying cells, which categorizes lupus as A) an allergy. B) an immunodeficiency. C) an autoimmune disease. D) an antigenic variation. E) a cancer.
- . A) What is the significance of producing monoclonal antibodies? B) What is the role of cell culture in production of monoclonal antibodies? C) Name and briefly explain the use of any 4 commercially available monoclonal antibodies.1.The passing of antibodies into newborn babies by their mothers is known as: A) active immunity B) passive immunity C) primary immune response D) antigens The immune system responds to the antigens found on invading microorganisms by: A) producing antibodies B) antibodies preventing the microbe from causing infection C) marking the microbe so that it can be attacked by white blood cells D) all the aboveWhich, if any, of the following statements is incorrect?a) Each person makes many millions of different HLA proteins so as to be able to recognize and bind foreign antigens.b) Classical HLA proteins are highly polymorphic; non-classical HLA proteins show very limited polymorphism.c) Classical class I HLA proteins are displayed on the surface of very few cell types, notably immune system cells.d) HLA proteins are the most polymorphic human proteins.
- Sutures() A) should be left in the skin for a minimum of 2 weeks B) often need to be removed with local anaesthetic C) must be tied tightly so that arterial inflow into tissues is not possible D) are left in situ for a longer time in patients who are immunosuppressed E) of all types must eventually be removedWhy might erythroblastosis fetalis occur when an Rh- mother becomes pregnant with a second Rh+ baby (after exposure to the previous Rh+ baby's blood)? A) Erythroblastosis fetalis can only occur when an Rh+ mother becomes pregnant with an Rh- baby. B) After primary exposure, if the Rh- mother has an Rh+ baby, then antibodies the mom produces can cross the placenta and attack the baby's blood. C) The Rh- mother always produces antibodies to the Rh+ blood, so erythroblastosis fetalis is a condition that can happen to any Rh+ baby (first or subsequent).A deficiency of both B cells and T cells is most likely a(n)... a)secondary immunodeficiency b)complex immunodeficiency c)acquired immunodeficiency d)primary immunodeficiency e)induced immunodeficiency
- Breast feeding provides which of the following to an infant?a) Artificial active immunityb) Artificial passive immunityc) Natural active immunityd) Natural passive immunityThe figure above depicts an antibody. For the labeled areas, which statement among A-D is not correct? A) O Mature, functional IgA antibodies possess a total of two sites labeled A B) O Your IgM antibodies are all similar in these areas: A C) O During opsonization, area B would bind to a bacterium D) O Your IgD antibodies are all different in this area: B 111 E) O None are matched correctly. B.One very effective treatment for SARS-Cov-2 is the injection of serum containing antibodies from recovered patients into the blood stream of infected, symptomatic, non-recovered individuals. This type of treatment is an example of: A) innate immunity B) naturally acquired active immunity C) naturally acquired passive immunity D) artificially acquired active immunity E) artificially acquired passive immunity