Here is a nucleotide sequence: ATGCAAGGTT. Choose the answer that correctly identifies both the type of nucleic acid that this sequence represents and the complementary DNA sequence Select one: O a. DNA; TACGTTCCAA Ob. RNA; AACCTTGCAT Oc. • RNA; TACGTTCCAA Od. • DNA; AACCTTGCAT

Here is a nucleotide sequence: ATGCAAGGTT. Choose the answer that correctly identifies both the type of nucleic acid that this sequence represents and the complementary DNA sequence Select one: O a. DNA; TACGTTCCAA Ob. RNA; AACCTTGCAT Oc. • RNA; TACGTTCCAA Od. • DNA; AACCTTGCAT

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Draw a model of DNA. Be sure to include the names of the nitrogenous bases. thank you

A: DNA is a double helical structure that consist of nucleotides. Nucleotides consist of nitrogenous…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: DNA G C A strand DNA TA C TA C strand MRNA A U G U G codon TRNA anticod G on Amino Tryptoph Stop…

A: DNA is deoxyribonucleic acid which acts as a source of genetic material inside living organisms. DNA…

Q: Check the new protein created by your new DNA. Describe how this changed the protein (amino acid…

A: Deoxyribonucleic acid is a molecule made out of two polynucleotide chains that curl around one…

Q: DNA Sense G C A strand DNA Antisense TAC T strand AUG MRNA codon U TRNA anticodon Amino acid…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT

Q: Determine the characteristics of this piece of double-stranded DNA. GTCTTTTACTTGAAT…

A: DNA is the double helical structure that contains the information that help in inheritance. The…

Q: For #74 and # 75, convert the DNA sequence into mRNA, and then the mRNA into protein (amino acids).

A: DNA and RNA are the two forms of genetic material, found in most living organisms. DNA is…

Q: Yes, all mutations change the resulting protein. No, the amino acid sequence has not been changed.…

A: Deoxyribonucleic acid (DNA) is the material that carries inheritable information to the succeeding…

Q: following question is related to Restriction Enzymes and RFLP. Using EcoRl, which DNA sequence held…

A: Restriction enzymes, also known as restriction endonucleases, are a key tool in molecular biology.…

Q: for pa... Lightspeed System. rest up manny il Quiz | ReadTheory photo ONA/RNA Quiz #1 tarted: Feb 2…

A: The monomers of DNA are called nucleotides . Nucleotides have three components. answer is…

Q: On the diagram of this DNA molecule, match the letters to the corresponding components: (should only…

A: In the diagram below DNA is shown. DNA is made up of a monomer called nucleotide. Each nucleotide…

Q: If you have got the following DNA template molecules, which one of them will require more energy to…

A: Melting temperature is the temperature at which a double-stranded molecule of DNA is broken down…

Q: What is the nucleotide sequence of the complementary strand of this molecule AT GCGA? O CATAG O A AT…

A: Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are well known and well defined as the two…

Q: If mRNA is UUACGC what is the DNA? Read from right to left. O TGCATT O UGCATU O TTUCGC UCGUTT AATGCG

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Part A Drag the labels onto the diagram to identify the structural elements of a DNA molecule.…

A: DNA or deoxyribonucleic acid is the genetic material in living organisms that is composed of two…

Q: Transcribe and translate the DNA strand below. Remember to use the start and stop sequences.…

A: DNA is converted into mRNA, which contains the instructions needed to make proteins through the…

Q: ntify the type of mutation and how it would affect the protein made (amino acid) if the following…

A: DNA is what is inside the nucleus of mostly all cells. It carries the genetic information which is…

Q: ATGGAGAAGGGACCTGGCCCACAACTTTATCCGGCGACAATAACAACCACTAACCCGTCO…

A: When DNA is synthesized into m RNA the process is called transcription and when m RNA translates…

Q: Transcription and Translation Practice Directions: Read each sequence of DNA and transcribe it to…

Q: Check the new protein created by your new DNA. Describe how this changed the protein (amino acid…

A: Any change in the DNA is called mutation. Some Mutations are beneficial because they add on the…

Q: Here's a line of DNA code: TACACGCCAGAG Transcribe it: (USE caps, no spaces)

A: The process of transcription in which RNA is synthesized from the DNA strand is carried out by the…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: The following diagram shows a DNA palindrome. Supply the missing bases and use the circled base as…

A: DNA Palindrome sequence is a segment of DNA in which the nucleotide sequence on one strand reads the…

Q: (a) Complete the table, using a letter D, R or B, to show whether each statement applies to: DNA…

A: Genetic material is the hereditary substance in the cell. It carries all information specific to…

Q: The following is part of a DNA sequence. What is its complementary sequence? TGTTCGAGCCA □a.…

A: Complementary base pairing is a phenomenon where in the double-stranded DNA, guanine is always…

Q: Corn_AA DVVINHRCA---DYKDGRGIYCVFEGG---TPDSRLDWGPDMICSDDTQYSN--GRG 16 :: Figure: Sequence alignment…

A: Sequence alignment is defined as the arrangement of sequences of DNA, RNA, proteins to identify…

Q: You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are…

A: Replication is the process by which the DNA generates a copy of itself. Transcription is the process…

Q: The following is the base sequence on the coding strand of a DNA molecule: AAT GCC AGT GGT TCG CAC…

A: A mutation in genetics is a change to a gene's DNA sequence. These alterations may happen naturally…

Q: Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an…

A: Codons are three nucleotide sequences on an mRNA that code for specific amino acids during the…

Q: It asks to categorize the possible answers to a component of eukrayotic RNA, eukrayotic DNA or both:

A: DNA and RNA are both the genetic material that expresses the heredity characteristics from…

Q: You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and…

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Q: Which of the following molecules is directly formed from Pyruvate? (more than one answer). a.…

A: Pyruvate is a biomolecule that can be formed from various metabolites and can also be converted into…

Q: Use the chart to determine the correct amino acid that this DNA would 1 point code for - ATA

A: Introduction:- In order to determine the gene sequence based off an mRNA template. We can simply…

Q: Suppose you have subjected the two given samples of EcoRl digested DNA to get electrophoresis. Draw…

A: Gel electrophoresis is a separation technique where fragments of DNA are separated on the basis of…

Q: If a sequence of DNA has 20% Guanine bases how many Adenines would it have? Select one: O a. 10% O…

A: If a sequence of DNA has 20% Guanine bases, then it would have 30% Adenine. Hence, option (c) is…

Question

Here is a nucleotide sequence: ATGCAAGGTT. Choose the answer that correctly identifies both the type of nucleic acid that this sequence represents and the complementary DNA sequence
Select one:
Oa.
• DNA; TACGTTCCAA
Ob.
RNA; AACCTTGCAT
• RNA; TACGTTCCAA
Od.
• DNA; AACCTTGCAT

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Background

VIEW

Step 2: Explanation of incorrect options

VIEW

Step 3: Explanation of correct option

VIEW

Step 4

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

Below is the sequence of a single strand of a short DNAmolecule. On a piece of paper, rewrite this sequenceand then write the sequence of the complementarystrand below it.GTTCGCGGCCGCGAACComparing the top and bottom strands, what do younotice about the relationship between them?
None
Give typing answer with explanation and conclusion
Direction: Please answer letter B and email C thoroughly and explain your answer. Thank you so much.
Please Just write it in alphabetical order or write number and which choice number is correct for each part of the diagram, no need for any explanations. Please double check that you have wrote the correct answer. This is grade 12 biology. Thank you!
Determine the complementary DNA strand that would form. Next, write the mRNA that would form from each complementary DNA strand you created (normal and mutated). Remember that adenine in DNA matches with uracil in RNA, thymine in DNA matches with adenine in RNA, and guanine and cytosine go together. Normal DNA strand - CTG ACT CCT GAG GAG Mutated DNA strand - CTG ACT CCT GTG GAG
Use the three letter code for amino acids. If they stop codon is encountered use the word stop without quotation marks. A set of nucleotides in an original DNA strand reads: CTA CTC TTT. Transcribe the short DNA sequence. Then translate the same sequence.
Transcribe and translate the DNA strand Remember to use the start and stop sequences. ACGGTACCGTTAGCCGACATCGGGGACACTGACTCG
Check the new protein created by your new DNA. Describe how this changed the protein (amino acid sequence).BTW- I changed the second triplet CCA to ACA
In order to determine the purity of a DNA sample. spectrophotometry can be carried out at _______ to measure DNA, and _______ to measure protein. The ratio _______ is then calculated, and a number between _______ indicates higher purity. 280 nm; 260 nm; A280/A260; 0.5-1 260 nm; 280 nm; A260/A280; 0.5-1 260 nm; 280 nm; A260/A280; 1.5-2 260 nm; 280 nm; A280/A260; 1.5-2