henylalanine pell out the full name of the citric acid cycle Intermediate. If there ls more than one answer, separate them by a comma. Fumarato, Acetyl CoA Submit Previous Answers Request Answer X Incorrect; Try Again; 3 nttempts remaining Phenylalanine is not one of the three amino acids that can be directly converted to acetyl CoA. You should identity the hwo compone
Q: Which characteristic is shared by the ring forms of the given monosaccharides? * CH2OH CHO O= H- HO-…
A: Ring forms of monosacharides are formed by reaction of aldehyde or ketone functional group with one…
Q: Draw the structures of glucose, pyruvate, and acetyl coenzyme A; number (label) the carbons in each.
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Which would be faster to metabolize starch glucose galactose
A: Metabolism is a set of chemical reactions through which what we consume through food through diet…
Q: Do coconut oils contain cholesterol? Justify your answer.
A: Excess cholesterol is generated by a variety of variables, including the fat components of the diet…
Q: Enumerate the types of carbohydrates unit and explain each
A: A carbohydrate is a biomolecule composed of carbon, hydrogen, and oxygen atoms in a 2:1…
Q: Properties of Body Fluids.
A: "Since you have posted multiple questions, we will answer the first question for you. If you want…
Q: Calculate the frictional coefficient of a molecule of DNA of 20 base pairs in water at 20C; assume…
A: DNA or deoxyribonucleic acid is a polynucleotide chain made of monomeric units of nucleic acids.…
Q: During exercise when the body lacks an adequate supply of oxygen to support energy production, the…
A: When a person does workout, then the body has a tendency to lack a very high amount of oxygen…
Q: What factors can prolong the coagulation time? What is the reason for the use of siliconized glass…
A: The process by which liquid blood turns into a gel-like substance (blood clot) is referred to as…
Q: Explain the importance of carbohydrates in your body
A: Carbohydrates are among the most important biomolecules needed for the sustenance of life. They are…
Q: Which of the following is present in sphingolipids? a). fatty acid b). carbohydrate c). phosphate…
A: Lipid molecules are o amphipathic nature and these molecules are used to make the plasma membrane.…
Q: Alterations in our genome can lead to a variety of genetic diseases including cancers. These can be…
A: Genetic diseases occurs when some harmful variation occurs in the genetic makeup or genes of any…
Q: Do reducing sugars have a reactive anomeric carbon? explain
A: Carbohydrates are divided into 3 classes monosaccharides, disaccharides, and polysaccharides.…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: Contrary to legend, camels do not store water in their humps, which consist of large fat deposits.…
A: Tripalmitoylglycerol is formed by three palmitoyl-CoA molecules. As a result, it is required to…
Q: 20. Which of the following is NOT a precursor for gluconeogenesis? Select one: A. Ethanol B.…
A: Glucose is the simplest form of carbohydrate that is utilized for energy purpose. Gluconeogenesis is…
Q: Compare and contrast proteoglycans, glycoproteins, and glycosaminoglycans. Cite examples for each
A: Glycobiology means the study of the structure, and function of carbohydrates attached to…
Q: Collagen is a fibrous protein which involves interactions between multiple helixes. Ohas a highly…
A: Collagen is a structural protein found naturally in humans and animals. It constitutes upto 30% of…
Q: In your own words how are drugs and toxins can have direct and indirect stimulation of the motor…
A: Toxins and drugs are a conceivable and prevalent significant public health problem, but they…
Q: 38. "The sterol is a precursor to all compounds except" A.ergosterol B.testosterone C.bile salts…
A: We'll answer the first question since the exact one wasn't specified. Please submit a new question…
Q: Based on the knowiedge you gained from the cloning module, which of the lanes in th firure is…
A: PCR stands for a polymerase chain reaction. It helped in the lab to make millions of copies of a…
Q: What modifications can be done to streptomycin's structure to enhance its pharmacokinetics and…
A: Streptomycin is the primary found aminoglycoside antibiotic, initially isolated from the micro…
Q: Given a mixture of three proteins, A, B and C, with isoelectric points pIA = 4.2, pIB = 7.0 and pIC…
A: The isoelectric point (pI) of a protein is defined as the pH at which the net charge of a protein…
Q: What would be the final primer concentration if 0.5 ul of 10 uM primers were ad a PCR reaction with…
A: Introduction: A primer is a short strand of DNA or RNA that is usually about 18-22 bases and serves…
Q: The compound below which is labelled in two positions with 13c (as represented by the shaded…
A: Glycolysis is a catabolic pathway in which glucose is oxidized to two molecules of pyruvate in the…
Q: What is the first step that should be done in PCR testing?
A: PCR is the polymerase chain reaction. PCR test or polymerase chain reaction test is good method to…
Q: Which of the following statements are correct according to the article? Select one or more: O…
A: Introduction: Acetaminophen is a synthetic non-opiate derivative of p-aminophenol that is given…
Q: What is the difference between the first steps of DNA sequencing to PCR in terms of the number of…
A: PCR is expanded as a polymerase chain reaction. It is a technique that is used widely for the…
Q: Calculate the energy produced (in ATP molecules) achieved by complete oxidation of the hydrolysis…
A: Glycolysis involves the oxidation of mannose into pyruvate. Mannose enters glycolysis as…
Q: RESOLVE STRICTLY IN DIGITAL FORMAT, TO BE ABLE TO COPY TO WORD. THANK YOU Different varieties of…
A: The concetration of total alcohols and reducing sugar are two determined to be the important…
Q: What will be the effect of mutation that turns lysine to arginine
A: The mutations occur in genomic DNA but they will reflect in the form of protein sequence and…
Q: 3. One indication of the relative importance of various ATP-producing pathways is the Vmax of…
A: Pheasant pectoral muscles are clearly anaerobic, as expected from a bird highly trained for…
Q: What are the main functional groups present in carbohydrates? Illustrate and explain.
A:
Q: Problem 1 Yeast cells has been cultured on glucose (Table 1). The growth data follows the Monod…
A: The Monod equation for cell growth kinetics is given below; μ = μmax [S]Ks + [S] here 'μ' is…
Q: 3. Explain the importance of lipid content in the structure of biological membranes
A: The lipids which it encircle membrane proteins in biomembranes have a significant impact on their…
Q: Is it true that coconut oils contain no cholesterol? Provide reasons
A: Coconut oil is basically a tropical oil derived from the dried nuts of coconut palm tree.
Q: Monosaccharides can be obtained not only from dietary carbohydrates but other major sources include…
A: Monosaccharides is a one of the type of carbohydrate. Monosaccharides are also called as simple…
Q: what happens to the intactness of DNA if extracted DNA fibers were placed in buffer of pH 3?
A: Extracted DNA is generally stored in neutral pH.
Q: The fate of glucose in cellular respiration is to yield carbon dioxide. Is this statement true?…
A: Cellular respiration is defined as the process through which different organisms can combine their…
Q: Which of the following was used to extract DNA from the food products for the GMO lab? Ethanol…
A: DNA extraction is a technique to separate DNA from the given cell sample. It involves the steps…
Q: In normal mitochondria, which of the following is true for the rate of NADH consumption (oxidation)?…
A: Mitochondria occupy a significant part of the cytoplasmic extent of eukaryotic cells, and that they…
Q: There are 4 classes of biochemical families (Carbohydrates, Proteins, Lipids, and Nucleic Acids).…
A: Carbohydrates are classified as monosaccharides, oligosaccharides, and polysaccharides. The…
Q: Regarding cellular metabolism, mark the true statements: (a). Electrons from the oxidation of…
A: In cellular metabolism, complex sequences of controlled biochemical activities, often known as…
Q: Folate deficiency may lead to: a.Megaloblastic anemia b.Neural tube defects c.Microcytic anemia…
A: Folic acid is B family Vitamin. It aids in the formation of healthy new cells in the body. Folic…
Q: Which of the following describes a Z-DNA helix? a. It is inhibited by methylation of bases b. It is…
A: DNA is a polymer made up of two polynucleotide chains that coil around each other to form a double…
Q: is acetate present in TCA cycle? Are carbon atoms of acetyle-CoA are converted into CO2?
A: The citric acid cycle is an important metabolic process that links sugars, fat, and protein…
Q: On a per-carbon basis, where does the largest amount of biologically available energy in…
A: There are two major types of dietary lipids: plant-derived triacylglycerol and animal-derived…
Q: translation to the plasma membrane
A: Translation is a process in which mRNA is decoded into short peptide sequences made of amino acids.…
Q: Cellulose cannot be digested and thus does not contribute to the caloric intake in humans. A) True…
A: Cellulose is an intricate organic compound found in large quantities in nature. It is a polymeric…
Q: ased on the knowledge you gained from the cloning module, which of the lanes in the urs is…
A: Agarose gel electrophoresis is used to separate DNA molecules based on their size and analyze DNA…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Comparing Glycolysis Entry Points for Sucrose Sucrose can enter glycolysis by either of two routes: Sucrose phosphorylase: Sucrose + Pi fructose + glucose-1-phosphate Invertase: Sucrose + H20 fructose + glucose Would either of these reactions offer Jin advantage over the other In the preparation of hexoses fur entry into glycolysis?A Deficiency on 3-Phosphogtycerate Dehydrogenase Can Affect Amino Acid Metabolism Although serine is a nonessential amino acid, serine deficiency syndrome has been observed in humans. One such form of the syndrome is traceable to a deficiency in 3-phosphoglycerate dehydrogenase (see Figure 25.31). Individuals with this syndrome not only arc serine-deficient but also arc impaired in their ability to synthesize another common ammo acid, as well as a class of lipids. Describe why.GTP or ATP is produced during the conversion of isocitrate into ketoglutarate succinyl CoA into succinate fumarate into malate malate into oxaloacetate
- Understanding the Mechanisms of Reactions Related to Transketolase The mechanistic chemistry of the acetolactate synthase and phosphoketolase reactions (shown here) is similar to that of the transketolase reaction (Figure 22.30). Write suitable mechanisms for these reactions.vat *Pyruvate carboxylase, which catalyzes conversion of pyruvate to medbo which cat oxaloacetate, is a regulatory enzyme activated by acetyl-SCOA.A ms Ido Explain why this control is advantageous to organisms. el pidotes to 316q beisbianoo olovo bios bixdio eda ei ydw ni 169qqs son esob nopyxo 16Iuselom nouods nove mellodstem Slovo od to noijose s zonado nostoals ont To 9300098 opo bias oito any contenos ain't ty dopo of basi sio S OU *While acetyl-SCOA activates pyruvate carboxylase, it inhibits pyruvate kinase. Explain how this is consistent with the idea of 9 complementary control.pе pпiwollot or to doss to slovo bios sitio :eyswdisq otlodsjem E2- noitididat xosdb99tArrange the steps of breakdown of oleic acid (pictured below) in the correct order. 1 2 3 4 5 activation by acyl-CoAsynthe ✓ [Choose ] one cycle ofß-oxidationbeginning at the enoyl-CoAhydratasestep three cycles ofẞ-oxidation five cycles ofß-oxidation activation by acyl-CoAsynthetase enoyl-CoAisomeraseactivity enoyl-CoAisomeraseactivity V one cycle ofß-oxidationbegini V five cycles ofß-oxidation OH
- Part A Using abbreviations (not structures), write the reaction of coenzyme A that gives off energy (-AG). Match the items in the left column to the appropriate blanks in the equation on the right. CoA+ acetate acetyl acetyl CoA. COA acetyl Previous Answers Request Answer Submit Reset HelpHandwritten Identify the molecule names, enzyme name, enzyme classification and change in reaction(for glycolysis pathway)Acetyi CoA Oxaloncetate CoA NADH NAD: Citrate Isccitrate Malate NAD co NADH Funaate »FADH; FAD a- Ketoglutarate Succinate NAD ATP Succinyt CuA NADH ADP - P, If you were told to add one of the eight citric acid cycle intermediates to the culture medium fo yeast growing in the laboratory, what do you think would happen to the rates of ATP and carbon dioxide production? (see the above figure) a. There would be no change in ATP production, but the rate of CO2 production would increase. b. The rates of ATP production and CO2 production would both increase, c. The rate of ATP production would increase, but the rate of CO2 production would decrease. d. The rates fo ATP and CO2 production would both decrease.
- asapCitrate Synthase exists as a dimer but can catalyze the formation of only 1 citrate from Acetyl-CoA + Oxaloacetate at a time O True O FalseThere are eighteen (18) rows of boxes, for around 36-38 boxes total. Please see images attached. This is a pathway trace, with the final box showing "ribose 5 phosphate" as the end product. Any help is appreciated-thank you! glutamate to ribose 5 phosphate No a ketoglutarate dehydrogenase No pyruvate carboxylase No transketolase No transaminase You do get to have if needed: erythrose 4 phosphate asparate dihydroxyacetone phosphate bicarbonate ATP ornithine CO2