Given the following sequence of mRNA, choose which tRNA will be next to incorporate: UAC .....CGCUAAUGGUAUGCAGC.... A. 1 B. 2 C. 3 D. 4 E. 5 GUC UAC AUG
Q: Question 22 Single stranded binding proteins assist transcription True False Question 23 A…
A: Transcription:Transcription is the synthesis of mRNA in 5' -> 3' direction from the template…
Q: a. For the E.coli haploid genotype below, determine the phenotype for the following proteins. Assume…
A: An operon is a segment of DNA containing a cluster of genes that are regulated by a single promoter…
Q: QUESTION 3 Discuss each of the following topics and provide appropriate example/s of each where…
A: A virus is a microscopic infectious agent that can replicate only inside the living cells of…
Q: Controls the outputs of the cortex and regulates motor activity. Central pattern generators.…
A: The segmental level refers to the neural processing that occurs at the level of the spinal cord. It…
Q: What is the relationship between dilution factors and the efficacy of antimicrobial agents in…
A: The relationship between dilution factors and the efficacy of antimicrobial agents refers to the…
Q: Which of the following statements are correct? A. Signalling molecules that are lipid-soluble bind…
A: Cellular signalling is a complicated communication mechanism that allows cells to respond to and…
Q: How many ATP (net) are made in the glycolysis part of cellular respiration? How many ATP are made in…
A: The complete oxidation of glucose to yield ATP is referred to as cellular-respiration. There are…
Q: From a kinetics experiment, Kcat was determined to be 55sec^-1. For the kinetic assay, 0.05mL of a…
A: When the enzyme is saturated with a given substrate then the maximum rate of enzymatic reaction is…
Q: Nerve fibers Blood vessel Axon Myelin sheath Blood vessels Ⓒ Thalamus Free nerve endings (pain,…
A: Sensory ascending pathways are neural pathways that transmit sensory information from the peripheral…
Q: Give typing answer with explanation and conclusion As a consultant plant pathologist, a commercial…
A: As a consultant plant pathologist, I would suggest the following four possible control measures to…
Q: Which of the following are examples of how plants can either benefit or fool herbivores or…
A: 1- A flower produces nectar to attract bees.The flowers which are pollinated by insects are bright…
Q: Discuss each of the following topics and provide appropriate example/s of each where necessary.…
A: Note - we are supposed to answer three subpart of a question, please repost other questions…
Q: In two independent PCR reactions, reaction A took 15 standard PCR cycles to obtain 1.31 × 108 copies…
A: PCR or the Polymerase Chain Reaction is a molecular technique widely used to syntheise multiple…
Q: Please list the social impact caused by Coronavirus disease (COVID-19)
A: Coronavirus diseaseIt is commonly known as COVID-19. It refers to the infectious illness caused by…
Q: Differentiate between hemodialysis and peritoneal dialysis.
A: Dialysis:-Dialysis us a special type of process that removes waste products and also excess fluoid…
Q: A garden measures 3.0 m by 4.0 m contains 215 roses. Find the population density of the roses. Show…
A: Population density is the number of individuals of a given population in a unit area. Usually,…
Q: Give only typing answer with explanation and conclusion The expected phenotype ratio in the F2…
A: Alleles are the alternative firms of a gene that are located on the same locus of a homologous…
Q: as an avid advocate for the adoption of ethical codes in sport, provide a description of usa cylist…
A: In highly competitive sports, athletes sometimes use performance-enhancing substances. Using such…
Q: Question 1 (1 point) Which statement(s) about the lac operon in E. coli is correct? O A) It is an…
A: The lac operon in Escherichia coli (E. coli) is a well-known example of gene regulation in bacteria.…
Q: 1) What type of organisms can carry out photosynthesis?
A: As, the question carries multiple sub questions inside, we have answered the first one for you.…
Q: How viruses are inhibited by interferons
A: VirusesThese are microscopic infectious agents that infect living organisms. They depend on the…
Q: True or False: The traits of individuals who produce more surviving offspring spread through the…
A: Traits are observable characteristics or attributes of an organism that can be inherited and passed…
Q: What role does the gut microbiota play in regulating eating behaviors and food preferences?
A: The gut microbiota, also referred to as gut flora or gut microbiome, is a complex community of…
Q: e fluorescent label in this image is he cell shapes are imaged with The microscopy used for…
A: In the image given some kind of cells are present which are glowing. Some cellular processes are…
Q: Ferns are a type of terrestrial plant that does not produce seeds, unlike gymnosperms and flowering…
A: The ability to produce seeds has provided significant advantages to gymnosperms and flowering plants…
Q: 24. Only 30% of adult humans can hydrolyze lactose. Unlike their lactose-intolerant fellow humans,…
A: The ability to digest lactose, the sugar found in milk, varies among adult humans. Approximately 30%…
Q: nvestigate the changes in taxonomy since Linnaeus. Note major changes, such as the recognition that…
A: 1)The field of taxonomy, which involves the classification and categorization of organisms, has…
Q: Prior to subculture, Tifa used a hemocytometer to count her HepG2 cells cultured on a T-25 flask.…
A: In the field of cell culture, accurately assessing the viability and concentration of cells is…
Q: In certain plants, red flowers are dominant to white flowers. If a heterozygous plant is crossed…
A:
Q: what structures make up the main body of most fungi? Mushroom cap Stems Mycelium Leaves Roots
A: Fungi are the organisms that are devoid of chlorophyll hence they are heterotrophs that is are…
Q: It is estimated that approximately 20,000 grizzly bears live in Western Canada, Yukon, and Northwest…
A: When a number of individual lives within a specific location is known as population density.It can…
Q: The energy from Photosystem 2 and Photosystem 1 -ATP and NADPH, help break down what molecule.
A: Photosynthesis - is a process in which energy from sunlight is transformed into chemical energy that…
Q: Consider this claim: Changes in environmental conditions always result in new ecosystems and loss of…
A: The relationship between environmental conditions and ecosystems, as well as their impact on…
Q: Examining Table 20-4, what do you think would be the order of mutations fixed during selection in a…
A: The frequent frequency of non-synonymous to synonymous substitution in coding regions, a…
Q: Describe how the use of HIV combination therapy has improved the wellbeing of infected patients.
A: The treatment for HIV is ART- Anti Retroviral Therapy. Though ART cannot completely cure HIV it can…
Q: Cross a true-breeding plant that produces yellow seeds with a plant that produces green seeds. a)…
A: The gene is the sequence of nucleotides present in the DNA. Each gene codes for a specific trait.…
Q: Explain how muscle velocity changes with varying muscle force (tension) during the different types…
A: The process in which the fascicles i.e. the muscle fibers become short and enlarges to produce…
Q: What is the role of potassium acetate in RNA extraction?
A: RNA extraction is a fundamental process in molecular biology that involves isolating RNA molecules…
Q: give pictures and Identify and label the parts of trachea, lung, larynx, bronchiole and epiglottis…
A: The human respiratory system does the gas exchange in the body. It consists of several organs such…
Q: Culture Change
A: The above statement explains about Cultural and inequality.
Q: Answer the following questions briefly and concisely 1.How do bacteria in a chemostat and those in…
A: If the dilution rate in a chemostat is higher than the organisms maximum specific growth rate it…
Q: Refer to the experimental approach (i.e., very briefly describe) and give the results AND…
A: A short RNA molecule called a microRNA, or miR-145 is involved in the post-transcriptional…
Q: (iii) Comment on the passage number of A and B cells. State your reasor (iv) Other than the passage…
A: TERT stands for telomerase reverse transcriptase and TR stands for telomerase RNA. TERT plays an…
Q: prescriber ordered Demerol (meperidine HCL) 75 mg IM q4h prn pain. The vial is labeled 100 mg/mL.…
A: To calculate the number of milliliters required, you need to determine the amount of Demerol…
Q: 2. Chemical X inserts channels into bacterial cell membranes. Rhodospirillium, a purple non-sulfur…
A: Photosystem I and Photosystem II are the two protein complexes present in cellular organelles of…
Q: Discuss how viruses are inhibited by interferons and how some viruses have evolved resistance to…
A: An infectious microbe which consists of…
Q: Show an example of life cycle management of a specific device ECG monitor
A: ECG monitor or Electrocardiogram monitor is medical equipment widely used to check the health of the…
Q: structure of mitral valve
A: The mitral valve is one of the four valves found in the human heart. It is situated between the left…
Q: Fill in the gaps in the paragraphs below: Blood pressure can be regulated by the nervous system, in…
A: The two parts of the autonomic nervous system are- sympathetic and parasympathetic. The sympathetic…
Q: A genetic autoimmune disease is caused by a single recessive allele a that is located on the…
A: In this genetic scenario, a rare autoimmune disease is caused by a single recessive allele, denoted…
Give correct detailed Solution..I will give you upvote
Step by step
Solved in 3 steps
- (b) Hemoglobin is made of B-globin subunits. The first few mRNA nucleotides for B- globin are given by: (1) (iii) (iv) Write down the DNA sequence that has led to this mRNA and indicate the sense and non-sense strands and the polarity. CE Derive the polypeptide for the sequence using the table of the genetic code (Table Q1 below) and indicate the polarity of the polypeptide chain. First Position (5' end) U A single point mutation in mRNA sequence can cause sickle cell anemia by changing the amino acid Glu to Val. For the given mRNA, indicate the point mutations for the first Glu in the polypeptide sequence that can cause this disease. 5'-AUGGUCCACCUGACUCCUGAGGAGAAG...UGA-3' C The polypeptide of B-globin contains the amino acid Leu. Write down all the anticodons of the tRNA molecules that can potentially code for Val. Indicate the polarity of the anti-codon. A G Table 1. The Codons of the Genetic Code Second Position U Phe Phe Leu Leu Leu Leu Leu Leu Ile Ile Ile Met-Start Val Val Val…Provide the abbreviation for the amino acid sequence expected from the following mRNA segment using the three-letter amino acid codes: 5' UUUICCCIAAUIAUUIACG 3'4a) Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence: 5'AUGCGACCUAGCUAUGGA3'
- Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'give the amino acids specified by the following bacterial mRNA sequences. a. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′ b. 5′ –AGGGAAAUCAGAUGUAUAUAUAUAUAUGA–3′ c. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′ d. 5′ –GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA–3′What potential polypeptides can be produced from the following mRNA sequence? There are more than one answer.. 5’ ...GGAGCUCGUUGUAUU... 3’ a. ser-ser-leu-tyr b. leu-cys-cys-ser-arg c. gly-ala-ser-trp-ile d. gly-ala-arg-cys-ile e. glu-leu-val-val f. You can't translate without a start codon. I know (d) is one of the answer but I'm stuck on how to find the rest. Please help.
- Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′We have a eukaryotic full-length mRNA molecule consisting of 33 bp5ʹ -... ACGAUACGUAUGCUCGAGAUCCGAGACUAUGUU ...- 3ʹ a) What are the first five amino acids that are translated? b) Describe how the ribosome finds the translation start on the mRNA transcript from prokaryotic and eukaryotic genes, respectively.
- The sequence below (A) was read from the autoradiogram (B). (A) 5' TGTACAACTTTTACTTAGGGCCGTGACACCTAAAG. 3' (B) Negative end ACGT Positive end C. Compare the sequence to the autoradiogram. How is the sequence read? Explain your ans d. Suppose that you want to express the correct protein product of an eukaryotic gene in a bacterial cell using a plasmid vector. What single sequence related factor must your consider in the cloning experiment?Given the following DNA, (A) what is the transcript (MRNA) sequence? (B) What might be the amino acid sequence of the translated protein? 5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3'8.) Answer the following questions regarding the following DNA sequence. 3'TACGGGGATAGCCGGCGAATTAAATAGCTGTC - 5" A.) What is the MRNA sequence that would result from transcription of this sequence? Assume that the DNA would be read from left to right. What is the amino acid sequence that would result from translation of B.) the MRNA resulting from the sequence? See Codon Table on next page. 20 C.) What is the anti-codon found on the tRNA that would deliver the amino acid for the first codon in the MRNA sequence? D.) If the fourth nucleotide in the DNA sequence were deleted due to a mutation during DNA replication, what would the resulting amino acid sequence be? What type of mutation is this? E.) What impact would the mutation in the DNA sequence in PART D have on the function of the protein produced from original sequence? Why?