Table 5. three deletions RNA 5' protein 1 2 3 FORD Staples. Table 1. normal protein 1 2 Frameshift mutation worksheet 35 DNA 3' ATTGTGTACTAAAAGCATTTTACAGACTGAAGGTTG RNA 5' UAACACAUGAUUUUCGUAAAAUGUCUGACUUCCAAC protein MET ILE PHE VAL LYS CYS LEU THR SER ASN Table 2. deletion at position #2 1 3 5 RNA 5' AAACAUGAVUUUCGUAAAAVGVCUGACUUCCAAC protein THR H PHESER ASNVAL LEUPRO

helpp, if u could do this one first please

Part B/D?

RNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…

me e File Content 911 Edit verview....pdf X PDF view Histor Biol 140 X Doordena Content acconline.austincc.edu/ultra/courses/_891351_1/cl/outline X Begin: X O Tutorial X Match each term with its best description. You may use each answer choice more than once. location of transcription in prokaryotes RNA triplet on tRNA which pairs complementary to an mRNA codon to ensure correct amino acid is brought into the ribosome during translation 18 Unit 3 X location of translation in all cells process of rewriting DNA code into mRNA code mRNA triplets which code for a specific amino acid Unit 3 ( x process of converting an mRNA transcript into a seuence of amino acids making up a polypeptide folded RNA that carries amino acids and transfers them to the ribosome during translation makes up ribosomes along with proteins location of transcription in eukaryotes intermediate between DNA and protein interpreted as codons specifying certain amino acids Content Your disk is alme Save space by op A.…

Complete number five.. please explain

pcc300ATAAADATATAOOTTAA 1. Use the genetic code table and the information in the diagram below to determine the amino acids that would make up the portion of the polypeptide shown. Include information for a key as well. DNA template 3' G CATA ACAGAGGATT-5' al bnsua AMAm pniwollot erfT E transcription s yd bnsita ebitgeqylog s sidmeaze of beae RNA strandUU UAOUOUU A-emoaodin 5'-CGUA AUUGUC UCCUUA- 3' J J JL erit o elinW (s) translation bluow terdt aspnso sigootiwsone polypeptide viemetis ns ebivo19 (d) ent ot etslanT Key:

Question in Image. Thank you!

100All tRNA molecules have poly (A) tails at their 3' end. Yesorno

Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G