Following transcription, the RNA has a complementary sequence of which of the following? Question 9 options: A) regulatory sequences B) termination sequences in the coding strand of DNA C) the template strand of DNA D) none of the answers are correct

Q: Can you please answer number 31

A:

Q: In the diagram of DNA at the right: a) fill in the letters representing the bases on the right-hand…

A: Introduction :  The genetic material in most organisms is DNA or Deoxyribonucleic acid. The…

Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…

A:

Q: Question 1: Define and give an example of the following: Codon, Start Codon, Anticodon, and Stop…

A: In molecular biology,  translation is the process by which the data stored in mRNA is converted into…

Q: 2.5 Which of the following is true about translation? A) The anticodon in the transfer RNA is…

A: t- RNA is called transfer RNA which changes to amino acyl RNA with help of the aminoacyl t-RNA…

Q: 18) UV radiation damages DNA by causing... a) frame-shift mutations b) base substitutions c) bonds…

A: Introduction Genetic variation is very important for evolution, but genetic stability is crucial for…

Q: Match the function in translation to each type of RNA (one RNA has two listed functions). 1) Carry…

A: The process where RNA transformed into protein called translation. There are all three types of…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: The following statements are correct EXCEPT: A) Information in the DNA is transcribed int mRNA and…

A: DNA is a genetic material which is safely stored inside the nucleus of the cell . It is ladder like…

Q: Which of the following would base pair with an aminoacyl tRNA? Question 33 options: A) 5'-UGA-3'…

A: Aminoacyl-tRNA is tRNA to which it's cognate amino acid is chemically bound. The Aminoacyl-tRNA…

Q: Transcribe the following DNA sequence.  Then translate the resulting mRNA transcript.…

A: Mutation is any change in the DNA sequence. It can alter the protein sequence because the proteins…

Q: Which of the following recognizes the mRNA codon 5' - U A A - 3'?

A: Firstly, information is transferred from the DNA to mRNA by the process known as transcription. Then…

Q: Identify whether each of the following descriptions applies to typical prokaryotic genomes only,…

A: In these questions, we will learn about different things in cells, like their DNA (the instructions…

Q: The characteristic way in which the DNA molecule is copied to form mRNA is most related to: a) the…

A: Introduction Transcription takes place in the nucleus, During transcription, It uses DNA as a…

Q: scientist uses a molecule of DNA composed of radioactive nucleotides as a template for replication…

A: DNA replication is the process of formation of exact duplicate copy of DNA. Transcription RNA is…

Q: Problem 1: a) Given the strand of the DNA sequence below, REPLICATE its complimentary DNA partner…

A: DNA replication is described as process in which the double stranded DNA molecule is copied into two…

Q: Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write…

A:

Q: THEME I: Please label and rank the following point mutations in increasing order of their potential…

A: Label and rank of the given mutations in increasing (smaller to larger) order of their potential to…

Q: Which of the following statements most accurately describes the action of the enzyme RNA…

A: Transcription is defined as the synthesis of mRNA from the template strand of DNA.

Q: Which of the following is NOT a function of DNA polymerase I in E. coli? Question 1 options: A) 5'…

A: Answer: C) Helicase

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.