230 million light-years A B с D E A ויו B 800 million light-years 2 billion light-years [Choose ] 2nd fastest 4th fastest slowest fastest 3rd fastest Choose] [Choose ] [Choose ] 70 million light-years 5 billion light-years Rank the galaxies based on the speed with which each should be moving away from Earth due to the expansion of the universe, from fastest to slowest. 230 million light-years A B U A D B 800 million light-years 2 billion light-years [Choose ] [Choose ] [Choose ] [Choose ] 70 million light-years < > 5 billion light-years E

Q: Select ALL the terms from the list below that correspond to the organism pictured. | Filter-feeder…

A: The cells are the primary unit of life. Based on the number of cells the organisms are classified…

Q: Q1.32. In the terrestrial phosphorus cycle illustrated below, at what rate is the size of the plant…

A: Phosphorous is introduced into soil by the weathering of rocks. The soluble phosphorous is then…

Q: TRUE or FALSE: More energy is used during photosynthesis to produce one molecule of glucose than is…

A: Photosynthesis is a multistep process and in its one of the step z-scheme engergy and nadp+ formed…

Q: Which one of the following laws for dissolved gases in water is NOT true? O a Warm water can hold…

A: Water is the universal solvent. It is made up of two hydrogen and one oxygen molecule.

Q: #5: What factors contribute to Uranus experiencing "the most extreme seasons in the Solar System"?…

A: The seventh planet from the Sun with the third biggest width in our planetary group, Uranus is…

Q: Match each type of microscopy to its description Oldest type of microscopy; uses glass lenses to…

A: Microscope is an instrument generally used in laboratories to examine objects that are too tiny to…

Q: Please let me know what you find out, it could be quite the discovery if we can figure out how these…

A: Genetic inheritance: An offspring obtain traits from their parents through sexual or asexual…

Q: Cheatgrass is an annual grass plant native to Eurasia that was unintentionally introduced into the…

A: Introduction: A population is all the organisms of the same group or species, which live in a…

Q: What is the main function of the DNA? * O It can be mutated. It stores information for protein…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: Skeletal System: Posterior View 7. 8. 9. 10. 11. 12. 1. 2. 14. 15. 16. 17. 23. 24, 25. 26. 27. 18.…

A: The skeletal system in human body is made up of 206 individual bones. The skeleton system is divided…

Q: Familial Down syndrome is similar to primary Down syndrome in that it is caused by trisomy 21.…

A: thank you please give a like    if there is any Non-loaded images in answer section, it will be…

Q: Hardy-Weinberg Practice Problems *Remember: p2 + 2pq+q2 = 1 and p + q = 1 *Remember: p2 = AA, 2pq =…

A: According to the Hardy-Weinberg principle, allele frequencies in a population are stable and remain…

Q: 3. Wild animals placed in zoos sometim result from a(n) _ in the anir O decrease; cortisol O…

A: Because the animals are well fed yet get a very little exercise in their cramped enclosures, many of…

Q: You perform a Gram stain on some yogurt that you made. What type of organisms do you expect to see…

A: INTRODUCTION Fermentation Fermentation is a process by which carbohydrate converted into sugar and…

Q: D. Hardwood forest stage C. Pine forest stage A. Grass stage B. Shrub stage Bare field 1. What…

A: 1. In the diagram, succession concept is illustrated as initially it is the bare field and then…

Q: Use the information in the figure, below. Include units in your answer. Round numbers to 3 decimal…

A: BSA standard curve: Bovine Serum Albumin(BSA) is a Globular protein that is being used as a standard…

Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five…

A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5…

Q: The zone where the ocean's salinity increases rapidly w/increasing depth is called the: O a…

A: Halocline is a kind of chemokline created by a greater vertical salinity gradient in a reservoir.…

Q: In Michaelis menton kinetics which variable is held constant? multiselect a. substrate concentration…

A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…

Q: tarted (B) Calculate completion time. 12. After 1 hr 30 min, 350 ml of a 1000 mL IV has infused. It…

A: Infusion rate is defined as the rate at which the drug is administered.  Factors influencing the…

Q: A given substance would require active transport across a lipid bilayer into a cell if... (choose…

A:

Q: This type of ion channel allows K+ ions to flow into or out of a cell down its concentration…

A: Ion channels are transmembrane proteins present in the lipid bilayer of the cell membranes. These…

Q: Blue V [ Choose ] Fibrous cartilage Hyaline cartilage Red [ Choose ] Acts like a seat cushion…

A: Cartilage is a supportive connective tissue that is made of glycosaminoglycans, proteoglycans,…

Q: An uncatalyzed reaction has a rate of 4.2 x 10-7 sec-1. When an enzyme is added the rate is 3.2 x…

A: Enzymes are proteins present inside organisms, which function to work as biological catalysts. These…

Q: tood time Ime Iml Iml ml Tml 99 99 99 9. 0.1 ml 0/-1 ml T5A plates TMTC 219 2나 colonies bacteria in…

A: Pour plate method: The technique is performed to count the number of microbial loads in a sample.…

Q: can you please solve for the numerical angle values of each below and flexion for knee and ankle…

A: To calculate the segment and joint angles, we need to use trigonometry to determine the angles…