e. Identify the maximum number of amino acids in a polypeptide chain produced by a DNA containing 225 nucleotides. UAA, and UAG code for which amino acid? STOR g. If a polypeptide is 210 amino acids long what is the minimum number of nucleotides in the mRNA molecule required for the synthesis of that chain?

Q: DNA MANNMANN B mRNA Transcription Transport to cytoplasm for protein synthesis (translation) Mature…

A: Introduction :- Protein synthesis is the process of creating proteins from amino acids inside live…

Q: c) Give an account of how messenger RNA (mRNA) is produced in the cell nucleus (transcription) and…

A: Hoe mRNA is produced in cell nucleus : in molecular biology messenger RNA ( ribonucleic acid  ) is a…

Q: Explain the term polycistronic mRNA.

A: An m RNA that can encode for many proteins is known as polycistronic m RNA.. This m RNA is present…

Q: Discuss the significance of modified bases within tRNA molecules.

A: There are four nucleotide bases present in DNA such as Adenine (A), Thymine (T), Guanine (G) and…

Q: During MRNA splicing... intron-exon boundaries are marked by exon junction complexes. the 5' cap and…

A: mRNA splicing is a process in which a newly-made precursor mRNA transcript gets converted into a…

Q: The second MRNA molecute is the acias they code Ior. same as the original mRNA except it has an…

A: Mutation It is defined as the alteration in the sequence of DNA due to the exposure to some mutagens…

Q: DNA sense or template DNA sense or template mRNA tRNA protein 5', 3' amino or carboxyl 5' T A U A R…

A: DNA -> Transcription -> mRNA -> Translation -> ProteinTranscription is the synthesis of…

Q: le) Frrors may occur during DNA replication, resulting in a change to the sequence of base triplets.…

A: Through the replication process, the information from one DNA molecule is replicated to create two…

Q: Describe the various post-transcriptional and post-translational modifications that occur during the…

A: Post-transcriptional modifications are those modifications that occur after the completion of…

Q: Define . Nonsense codon  as they apply to the genetic code

A: Codons are the triplet of nucleotides present in DNA (deoxyribonucleic acid) or RNA (ribonucleic…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of…

A: Mutation -  Mutation is defined as the sudden inheritable changes in the structure of the DNA or in…

Q: a. Show (on the image) 3 steps that must be taken to produce a mature mRNA molecule from this pre-…

A: RNA Splicing: A newly created precursor messenger RNA (pre-mRNA) transcript is converted into a…

Q: Describe the process of transcription in as much detail as possible using pictures and words…

A: Note- According to the guidelines only one question can be answered at a time. Hence, one question…

Q: the translate on the mRNA in 5'AAA-AAA-AAA-AAA-AAA3' is?

A: Introduction :- In molecular biology , different processes of gene expression is studied , these…

Q: An mRNA has the following sequence:5′–AUG UAC UAU GGG GCG UAA–3′.Describe the amino acid sequence of…

A: Transcription DNA is converted to mRNA. this process is called transcription.

Q: Explain post-translational modification of proteins in general with the types of reactions. Provide…

A: Ans:--PMT's are enzymatic , covalent chemical modification of protiens that typically occur ofter…

Q: DNA sense or template DNA sense or template mRNA tRNA protein 5', 3' amino or carboxyl 5' T U A A RG…

A: The genetic information for protein synthesis is stored in DNA. DNA is double-stranded. The…

Q: CCGGTGTACACAGGGACCATTCGATTA What is the mRNA:? Protein Phenotype?

A: The sequence of a protein is usually notated as a string of letters, according to the order of the…

Q: Describe translation. What is the function of the aminoacyl-tRNA synthase?

A: Protein synthesis: It is a process that involve peptide bond formation between the amino acids by…

Q: Consider the MRNA sequence below. Assume that the following mRNA segment has been translated.…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. A glycosidic…

A: Similar to Deoxyribose Nucleic Acid(DNA), RNA(Ribose Nucleic Acid) is a linear polymer composed of…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: Define about steady-state level of an mRNA ?

A: Answer- The mRNA is produced by the process of transcription reaction that happens in the nucleus of…

Q: following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA…

A: A) The output from the given nucleotide sequence is RYIF which is Arginine>Tyrosine>…

Q: . If tRNA is the adaptor for translation, what is theribosome?

A: Translation refers to the process of protein synthesis in the cells.  The process of translation…

Q: Name the three main stages of pre-mRNA processing. Explain the importance of each of the stages of…

A: Pre-mRNA, or precursor mRNA, is an immature RNA molecule that is transcribed from a gene in the cell…

Q: Derive the amino acid sequence that is coded by this mRNA sequence. Use three-letter amino acid…

A: Proteins are made up of amino acids and are necessary for the efficient operation of all living…

Q: Open reading frames... correspond to introns, which are not read by the ribosome during translation…

A: The genetic material has various components on which the transcriptional and translational machinery…

Q: . A mutational lesion results in a sequence containing amismatched base pair:5′ AGCTGCCTT 3′3′…

A: Mismatch repair : It is a system for recognizing and repairing wrong insertions, deletions and…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: State the DNA sequence that encodes the anticodon that recognizes the codon AAG, with 5’ and 3’ ends…

A: An anticodon is a trinucleotide sequence that is complementary to the corresponding codon in a…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…

Q: 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you…

A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…

Q: Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence:…

A: Amino acid for AUG is Methionine Amino acid for CGA is Arginine Amino acid for CCU is Proline Amino…

Q: Complete the box below:     Convert the following template strand of DNA bases into its…

A: The production of RNA from the DNA is known as transcription. This process is also known as gene…

Q: Identify the secondary structures present in the protein and its genes code…

A: Proteins are large biomolecules that compose structural and motor elements of a cell, and also as…

Q: a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of…

A: A mutation is a change in a DNA sequence. It can result from DNA copying mistakes made during cell…

Q: Describe the function of the Bicoid protein. Explain how its ability to exert its effects in a…

A: The proteins are the biomolecules found in all organisms.

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.