Draw his trp arg pro glu met ile | PH = 2 1b) How many possible structures are there for this? 1c) Complete a diagram of the number of structures, its net charge and its pKa's 1d) Determine the pl of the peptide.

Draw his trp arg pro glu met ile | PH = 2 1b) How many possible structures are there for this? 1c) Complete a diagram of the number of structures, its net charge and its pKa's 1d) Determine the pl of the peptide.

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: Decide whether you will use peptide YAD or peptide SHY Draw the peptide at pH 7.

A: Given peptide 1) YAD 2) SHY Y = Tyrosine A = Alanine D = Aspartic Acid S =…

Q: What are the most common physical factors of a TRF biome?

A: The tropical rainforest are closer to equatorial region where it was hot ,moist biome .and rains…

Q: A solution of peptide of unknown sequence was divided into 2 samples. One sample was tre with…

A: Site specific proteases are enzymes that cleaves polypeptide chains only at specific sites i.e. at…

Q: 3. A mutation that changes an alanine residue in the interior of a protein to a valine is found to…

A: Proteins are composed of twenty standard amino acids that differ from each other in their side-chain…

Q: You have isolated this peptide. AÇQGRKSPWTT TAHEVYPGGCMN What products would you get if you treated…

A: The agents given in the question are the agents which cleave the peptide at certain amino acid…

Q: The following amino acid sequence corresponds to that of a venom produced by certain bees:…

A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…

Q: Peptide (amide) bonds are foundational to biochemistry. Use the instructions for drawing peptides to…

A: Amino acids are linked via peptide bonds that are formed between the carbonyl atom of an amino acid…

Q: 10. (a) Provide the scheme of Merrifield peptide synthesis with suitable example. (b) Describe the…

A: Amino acids are biomolecules that are comprised of two functional groups, these are an amino group…

Q: NH, SH NH, он HN C. H,N HN PEPTIDE RNGCSN NH, PEPTIDE AHIKP

A: Trypsin is a serine protease that is found in the digestive system of vertebrates where it…

Q: Pleasseee explain I’m confused…….

A: The charges of a peptide at different pH values depend on the ionization states of its amino acid…

Q: Trypsin digestion of the peptide sequence M3-E4-R5-P6-F7-Hg-Ag-10-A11-R12-T13-Y14- G15-P16 results…

Q: by namlng the amlno aclds from the N-terminal to the C- terminal. Use the long name, the 3-letter…

A: Bradykinin is a nonapeptide that means it contains 9 amino acid. At low pH, a peptide remain full…

Q: Write down your PDB protein code: …2V1X…… Write down the protein sequence number of your amino…

A: The Protein Data Bank is a database that contains the three-dimensional structural data of large…

Q: A researcher performed an SDS-PAGE experiment (with 2- mercaptoethanol) on a mixture containing 3…

A: G

Q: Which of the following statements about enzymatic catalysis is not true? O a. Enzymes are able to…

A: Enzymes are defined as complex compounds containing nitrogen. Catalysis is defined as a phenomenon…

Q: On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in the course of…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: mRNA: TCCGATGCCACGGGTCATCTCGGACGTGTGAATCGA 3. Your mRNA will now be translated. Refer to the genetic…

A: Inside the nucleus of the cell , DNA act as a template for the manufacturing of single strand of…

Q: Give only typing answer with explanation and conclusion Q: The peptide PICKHAPPY has what charge…

A: Proteins are the important biomolecules required for the body. Proteins are made up of amino acids.…

Q: Consider a peptide with sequence HQNY. (a) Calculate pl of this peptide. Show your work and pKa…

A: Amino acids are monomers that make up peptides. Amino acids that occur in proteins are α-amino…

Q: What percentage of molecules of peptide GGGG has no ionized groups (e.g. has BOTH protonated…

A: Amino acids: An amino acid can function as both an acid and a base because of its structural…

Q: (2) Determine the sequence of the peptide on the basis of the following data. Amino Acid…

A: Given that the peptide has 10 amino acids. The list of ten amino acids is as follows: Ile (I), Lys…

Q: Which amino acid is hydrophobic (does not dissolve in aqueous solutions)? Why?(a) glutamic acid (b)…

A: Hydrophobic amino acids have little or no polarity in their side chains. The lack of polarity means…

Q: Can you please help find what the n terminal is?

A: The pH of the solution is determined by measuring the acidity and basicity. The pH of less than 7 is…

Q: How the mutations change chemical nature of R group of amino acids? (like polar nonpolar/ charged…

A: Proteins are made of the basic subunits called amino acids. They are involved in different…

Q: Which primary amino acid sequences most likely represents an alpha helix stabilized by ionic…

A: Organic substances with both amino and carboxylic acid functional groups are called amino acids.…

Q: Answer for each 1, 2, 3, 4 and 5 labelled in the attached image: a)What is this molecule? b)What…

A: Answer: PROTEINS : These are the macromolecules which are needed by an individual. These are the…

Q: What side group reacts with this reducing agent? What does the fact that these peptides both react…

A: There are four levels of protein structure hierarchy: Primary structure, Secondary structure,…

Q: A protein with which of the following sequences may be more prone to undergo farnesylation? (a)…

A: Prenylation (or lipidation) is a process of "post-translational modification" (PTMs) of proteins by…

Q: As early as the 1930s, it was known that frog muscles could still contract when glycolysis was…

A: carbohydrate metabolism was the fundamental biochemical process which supply energy continuous to…

Q: At pH 7, draw the structure of Arg-Tyr-Gln-Glu-Lys. 2. What’s the charge of this peptide at pH 12?…

A: 1. At pH 7, the Arg-Tyr-Gln-Glu-Lys peptide would have the following structure: H H H…

Q: At pH 1, the charge on the C-terminal carboxyl group is

A: Peptide bond: When two amino acids are joined together releasing a water molecule and forming alpha…

Q: what is the sequence of peptide 1?

A: A nonpeptide is the a polypeptide containing nine amino acids linked via peptide bonds. The sequence…

Q: The neighboring amino acid that TYR 368 interacts with is ILE 160. What are the properties of the…

A: Amino acids are natural mixes that contain amine and carboxyl functional groups, alongside a side…

Q: you were given an unknown peptide. Explain in detail how you would determine the amino acid sequence…

A: The amino acids that form the protein are mostly L forms. The carboxyl group of amino acids in the…

Q: 1. How many different tripeptides are possible? How many carboxyl terminals of polypeptide chains…

A: Tripeptides are composed of three amino acids. There are 20 naturally occurring amino acids . A…

Q: Draw the structure of VEDMN at pH 12. What is the isoelectric point of the peptide (show how you…

A: Given peptide is composed of five amino acids so it will be called pentapeptide. The amino acids…

Q: Determine the net charge of the following peptide at pH 10 given the respective pKa's. DDDMCRVNAY…

A: The peptide is the sequence of amino acids that are joined by the formation of peptide bond between…

Q: Indicate whether each listed solid-phase peptide synthesis step is performed one time or performed…

A: Solid-phase peptide synthesis It involves the stepwise generation of a peptide chain joined to…

Q: Apamine is a small protein toxin present in the venom of the honeybee. Ithas the…

A: Apamin is an 18 amino acid globular peptide neurotoxin found in apitoxin.

Q: In relation to the peptide sequence that is presented. -Gly - Ser – Cys – Asp – Glu – Arg – Cys –…

A: The given peptide sequence contains 8 amino acids. In a peptide, individual amino acids are joined…

Q: Pleaseeeeeeeee explain the processs of this I’m so confuseddddddd………….

A: Refer to the solution

Question

1a)Draw his trp arg pro glu met ile | PH = 2

1b) How many possible structures are there for this?

1c) Complete a diagram of the number of structures, its net charge and its pKa's

1d) Determine the pl of the peptide.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Ionization of peptides

Answer to 1a)

Answer to 1b)

Answer to 1c)

Answer to 1d)

Step by step

Solved in 5 steps with 3 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

Please fill in the following blanks with the options that correctly finishes the sentence. a. At a low O₂ pressure the [Select] hemoglobin is in a [Select] [Select] [Select] 9 [Select] " bond with [Select] heme, and the protein's central channel is [Select] b. The proximal histidine forms a(n) [Select] state is stabilized. In this conformation state, the heme prosthetic groups is each subunit's heme is more likely to be the proximal histidine is [Select ] bond with while the distal histidine forms a(n) [Select] to the
I. A protein, X, was Isolated from a pathogenlc mlcroorganism. The proteln Is a vlrulence factor whose path0genlclty lies In a heptapeptide of unknown sequence. After trypsin cleavage of the heptapeptide from protein X, the peptlde's compOsition and sequence was determined. The fOllowing were the results of the sequenclng process: 1. When the peptide was treated with dinitrofluorobenzene (DNFB), DNP-asp and a mixture of amino acids were produced. 2. When the same Intact peptide was treated with streptococcal protease, a pentapeptide of composition asp, asN, cys, gly and ser and 2 amlno acids were released. 3. When the heptapeptlde was also treated with hydrOxylamine HCI, a tripeptide and a tetrapeptide were obtained. The C-terminal amino acid of the tripeptide was asN. 1) What is the sequence of the heptapeptide if it is composed of cys, asp, lys, asN, gly and ser only? 2) What is the pl of the heptapeptide?
Using the codon wheel below, identify which of the following mutations of the DNA sequence TTT TAC ACT would potentially have the least effect on the protein containing the sequence? Val (V) Ala (A) Arg (R) Ser (S) Start Stop Lys (K) Asp (D) Asn (N) G A Glu (E) U G A C U G G A A C U G C U G טןכ Thr (T) AGUCAGUCAGU GU Gly 4. A Phe (F) Met (M) Leu (L) AGUCAG C GU AC CUGACUGA A Ser (S) G כט SOTO. U C C Gin Arg (Q) (R) A CUG JGA Α /c/u/e\+\clejoke G U C U Tyr (Y) His (H) A G U C A Cys (C) Pro (P) Trp (W) Leu (L)
You are in the process of determining theamino acid sequence of a peptide. After trypsin digestion followedby the Edman degradation, you see the following peptide fragments:
Draw the peptide at a pH @1 of Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr
( please give answer in simple language and draw diagram where necessary) do 1st question
Is there a difference between the effects of acid concentrations on protein denaturation? Why?
You have digested a small protein with two different proteases, each protease acting on the protein in separate reactions. These are the peptide fragments generated: Trypsin: IPVK: Ile-Pro-Val-Lys ALEL: Ala-Leu-Glu-Leu HRPGDR: His-Arg-Pro-Gly-Asp-Arg FGADAEDGAMNK: Phe-Gly-Ala-Asp-Ala-Glu-Asp-Gly-Ala-Met-Asn-Lys YLEFISECIIQVLQSK: Tyr-Leu-Glu-Phe-Ile-Ser-Glu-Cys-Ile-Ile-Gln-Val-Leu-Gln-Ser-Lys Chymotrypsin: (Reaction conditions were used to maximize cutting to the C-terminal size of F, W, and Y.) LEF: Leu-Glu-Phe IPVKY: Ile-Pro-Val-Lys-Tyr GADAEDGAMNKALEL: Gly-Ala-Asp-Ala-Glu-Asp-Gly-Ala-Met-Asn-Lys-Ala-Leu-Glu-Leu ISECIIQVLQSKHRPGDRF: Ile-Ser-Glu-Cys-Ile-Ile-Gln-Val-Leu-Gln-Ser-Lys-His-Arg-Pro-Gly-Asp-Arg-Phe I am not sure what these questions are asking.
What charge is carried by the peptide FREEENERGY at pH 7? (pKas: N-terminus: 9; C-terminus: 3; Arginine 11.6; Glutamic acid, 4.3)
1. Search for the `P06858` a) Give information about the PTM and Processing of this protein. b) Which position has maximum amount of variations? Give details about the variations. (Eg: What kind of variation? Feature ID? Disease association? etc..)
2. (6) Examine the two proteins labelled a) and b). Which of the two Ramachandran plots, c) or d) is more likely to be derived from which protein? Explain how you determined this. (a) (b) (c) (d) ✓ (degrees) ✓ (degrees) +-180 120 60 -60 -120 -180 -180 +180 120 60 -120 -180 -180 0 (degrees) 0 (degrees) +180 +180
4. You're working on a structure of a protein and its folding. You think that the interaction between Asp123 and Arg29 is important in determining the structure of the protein. a) What type of amino acid is Asp (acidic, basic, hydrophobic, or polar)? b) What type of amino acid is Arg (acidic, basic, hydrophobic, or polar)? c) What is the strongest interaction that can form between Asp123 and Arg29? You create a mutant Arg29> Lys d) What type of amino acid is Lys (acidic, basic, hydrophobic, or polar)? e) Would you expect this substitution mutation to cause major folding problems? Why or why not? You create mutant Arg29> Glu you discover that this mutant is unable to fold properly, so the protein is nonfunctional. f What type of amino acid is Glu (acidic, basic, hydrophobic, or polar)? g) How does this amino acid substitution cause the protein to fold incorrectly? You find another mutant that also as the same Arg29> Glu mutation. However, this mutant protein įs able to fold normally.…