draw a guanine nucleobase and label all possible H bond donor and H bond acceptor?
Q: Responses elicited by cAMP production EXCEPT glycogen breakdown increased secretion of…
A: G-protein is a GTP binding protein that is found closely associated with the receptor called…
Q: Consider a defect in MIG12 that prevents the binding of this protein to acetyl-CoA carboxylase. How…
A: Introduction: Acetyl carboxylase is a multifunctional enzyme that contains three functional domains…
Q: Which of the following statements concerning uncompetitive inhibitors is NOT true? a. They decrease…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: 5. Consider the oxidation of a mole of NADH using the following half reactions: 12 02 +2e + 2 H+ →…
A: Biological oxidation-reduction reactions involve the transfer of electrons from one biomolecule,…
Q: Which enzyme regulates the rate at which acetyl-CoA enters the citrate cycle? isocitrate…
A: INTRODUCTION:The primary function of the citrate cycle is to. convert energy available from the…
Q: Which of the following polypeptides CANNOT be phosphorylated? O a. -LIYLIA- O b. O C. O d. O e.…
A: A polypeptide is a chain of amino acid residues linked together via a peptide bond. Amino acids are…
Q: A type of diabetes mellitus is due to defects in insulin signaling. True False
A: Diabetes mellitus is a condition in which the insulin secretion from the pancreas is insufficient…
Q: Answer each question in the figure regarding reactants and products in the isocitrate dehydrogenase…
A: In the citric acid cycle, isocitrate dehydrogenase catalyzes the oxidation of isocitrate and…
Q: Which of the following amino acid side chains CANNOT form hydrogen bond? O a. Gln O b. Tyr O C. O d.…
A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines…
Q: 4. Write the equation for the digestion (hydrolysis) of Phe-Asp-Ala.
A: A tripeptide is made up of three amino acid residues linked via a peptide bond. A peptide bond is…
Q: During lactic acid fermentation ___ is converted to ___ thereby oxidizing ___ a. Pyruvate ;lactate…
A: Pyruvate is the end product of glycolysis.NAD+ is needed for production of pyruvate. Under aerobic…
Q: Which of the following is TRUE? Both AMP and ADP are negative regulators of glycogenolysis. O ATP…
A: Glycolysis is the catabolic pathway in which glucose is broken down into pyruvate that enters TCA…
Q: A mixture of lipids containing phosphatidic acid, cholesterol, testosterone, phosphatidylserine, and…
A: Non-polar molecules do not form a hydrogen bond with water can are thus considered hydrophobic.…
Q: "Implementation of PAT system in manufacturing of pharmaceuticals results in less validation and…
A: The term 'Process Analytical Technology' or 'PAT' was coined by the pharmaceutical industry and IPQC…
Q: The activated donor molecule for glycogen synthesis is UDP-glucose. O True O False
A: While glucose serves as the main source of energy, complex (i.e., more than single-celled) organisms…
Q: Which of the following enzymes is inhibited as a result of insulin binding to its receptor? glycogen…
A: Insulin regulates the level of blood glucose by stimulating the uptake of glucose from the blood…
Q: Discuss the chemiosmatic mechanism of coupling between electron transport and oxidative…
A: Chemiosmosis is the process of movement of ions across a semipermeable membrane down its…
Q: VII. Draw the structure of melezitose (either in Haworth or in conformer): a-D-glucopvranosyl-…
A: Melezitose is a trisaccharide made up of α-D glucose (1,3)-β-D-Fructose (2,1)-α-D-Glucose. Inorder…
Q: The phrases or terms describe different fundamental processes of nucleic acids. Classify each phrase…
A: Replication, transcription, translation are the three processes of central dogma of life.…
Q: Two villages in the Amazon depend on corn as a major staple in their diet. People in village A have…
A: Pellagra is a deficiency disease which is characterised by diarrhoea, mental disturbance, scaly…
Q: Which enzyme catalyzes the following reaction?
A: MM kinetics relates the initial rate of a reaction with initial substrate concentration when the…
Q: why are fast acting neurotransmitters typically are small molecules?
A: Neurotransmitter is a signaling molecule secreted by neurons to affect another cell across a…
Q: At which temperature given does hemoglobin have a higher affinity for oxygen?
A: Hemoglobin is a protein that transports oxygen from lungs to tissues and CO2 from tissues to lungs.…
Q: Which enzyme listed below is considered both a component of the citrate cycle and a component of the…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: Meselson-Stahl Experiment showed that DNA replication is semi-conservative. In the experiment, DNA…
A: During DNA replication, each polynucleotide strand serves as a template for the production of a…
Q: 7) In DNA/RNA chains, what is the direction of synthesis?
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Which of the following statements concerning fatty acid oxidation is NOT true? O b. Fatty-acid…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: Which of the following about the splicing in posttranscriptional processing is NOT true? O a. O b. O…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: What is the significance of NADH and FADH2 in ET/OP?
A: Aerobic cellular respiration is constituted of three parts- glycolysis, the citric acid cycle, and…
Q: Please answer both Note :- Other wise down vote.
A: The reactions that involve biomolecules are called biochemical reactions. These occur inside the…
Q: What is the molecular basis for the difference in the electrophorentic pattern between normal…
A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…
Q: The pancreas is an organ of mixed secretion. Endocrinely, beta-cells produce the hormone insulin,…
A: Hormones are signalling biomolecules that are released from endocrine cells into the bloodstream and…
Q: draw an amino acid. Use R for the side chains 2 draw a nucleotide triphosphate with an expanded…
A: The proteins are a major class of biological macromolecule that is constitute of twenty naturally…
Q: Consider the image of protein synthesis (translation). Identify the two different RNA molecules…
A: Translation refers to the process of protein synthesis. It falls under the process of gene…
Q: Considering that regulation most often occurs at irreversible steps in a biochemical pathway, which…
A: Enzymes are usually protein molecules which catalyze several biochemical reactions in our body…
Q: 1.0 ml of serum albumin (BSA) solution was precisely diluted to 100 ml with a buffer solution, and…
A: The proteins molecules are constituted of twenty naturally occurring amino acids. The aromatic amino…
Q: Consider a situation where a mitochondrion contained a defective complex III that resulted in only…
A: Electron transport chain consists of a series of protein arranged in mitochondria membrane and…
Q: Cell signaling systems: A. autocrine B. paracrine C. endocrine D. none among the…
A: Cell signaling systems is a process of cell-cell communication via receiving the signal, processing…
Q: 。. An investigator has a strand of chromosomal DNA whose sequence is shown. She wants to use…
A: PCR or polymerase chain reaction is a lab procedure that amplified fragments of DNA by using a…
Q: Choose all of the true statements about oxidative phosphorylation. Oxidative phosphorylation occurs…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by oxidation of…
Q: 1. Classification, structure and properties of higher fatty acids, their biological role.
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: A characteristic of complex III is that it is reduced by FADH2. participates in electron transfer…
A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron…
Q: Identify which of the following pairs of amino acid residues can have hydrogen bonding between…
A: The three dimensional structure of a protein is necessary for attaining its functional form. The…
Q: Choose the best answer for each blank. The pyruvate dehydrogenase (PDH) complex is regulated by the…
A: Glucose is oxidized during glycolysis and the end product (pyruvate) is converted to Acetyl CoA via…
Q: Explain how the information in mRNA is converted into a fully folded protein, and how the misfolding…
A: Introduction DNA is a self replicating molecule. mRNA is produced from DNA by a process called…
Q: FRET is a widely used biophysical technique for the characterization of a wide range of biomolecular…
A: FRET is a unique method for measuring the separation between a donor-acceptor pair of chromophores.…
Q: 1 what is the net reaction of the citric acid cycle? what happens to each product? 2 Starting with…
A: Citric acid cycle (or TCA cycle or tricarboxylic acid cycle) is the final common oxidative pathway…
Q: The basic elements or molecules of cell signaling I. second messengers - substances that enhances…
A: Biochemical cell signalling is the method by which cell communicates with each other cells and…
Q: The drug below is used in the treatment of: O Rheumatoid arthritis. O Gram(+) bacterial infections.…
A: Heterocyclic ring is a ring structure made up of different atoms. Given to us a heterocyclic…
Q: How does alteplase and mannitol affect a laboratory result? Why is it important to inform the lab…
A: Introduction An ischemic stroke is a condition when the blood supply to part of the brain is reduced…
Nucleotides
It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid).
Nucleic Acids
Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.
1 draw a guanine nucleobase and label all possible H bond donor and H bond acceptor?
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps with 1 images
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- CH3 23) In the following short nucleic acid circle and label the following structural elemen A: phosphodiester linkage, B: Cytosine, C: N-glycosidic linkage and D: 3'-phosphate. NH2 N. HO H. N- H. H. 0=P-0 N. NH2 NH2 H. N. H. N. 0=P-O H. H H. H. H. 1. 0=P-0 :- HIIdentify the type of base and sugar group present in each nucleotide or nucleoside. HO. H3C. CH₂ OH -²03POCH2 OH 'N N ΝΗ NH₂ Molecule 1 O pyrimidine, deoxyribose O pyrimidine, ribose purine, ribose O purine, deoxyribose Molecule 2 pyrimidine, ribose O pyrimidine, deoxyribose purine, ribose O purine, deoxyriboseDraw the potential tautomers of guanine. Based on Question 1c) (i), label the patterns of hydrogen bond acceptors, donors and non-polar atoms/groups in the minor groove of the GT base pair.
- (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21Given the structures of the ribonucleotides and deoxyribonucleotides: Adenine Uracil Thymine HN Adenine NH HO-P-0- CH2 HO-P-0 CH2 HO-P-0-CH2 HO-P-0-CH он он он он OH H OH H Cytosine Cytosine Guanine Guanine NH2 NH NH2 CH2 HOo CH2 HO-P-0 -CH2 он он он он OH H OH H • Draw the structure of the polyribonucleotide UAGCCUG. Draw the structure of the polydeoxyribonucleotide CGTAGAT.2. | Calculate the overall charge (pH 7) on the following three polypeptides and answer the questions below. Assume the following pKa values: N-terminal -NH3®, 7.0; all -COOH groups, 4.0; Arg, 12.5; Cys, 8.4; His, 6.0; Lys, 10.0; Tyr, 10.0. (A) Ser-Tyr-Ser-Met-Glu-His-Phe-Arg-Trp-Gly-Lys-Pro-Val-Gly-Lys-Lys-Arg-Arg-Pro-Val-Lys-Val-Tyr-Pro-Asp-Ala -Gly- Glu-Asp-Gln- Ser-Ala-Glu-Ala-Phe-Pro-Leu-Arg-Glu-Phe (B) Ser-Tyr-Ser-Met-Glu–His-Phe-Arg–Trp–Gly-Ala-Pro-Val-Gly-Glu-Glu-Cys-Asp-Pro-Val-Glu–Val-Tyr-Pro-Asp- Ala-Gly-Glu-Asp-Gln-Ser-Ala-Glu-Ala-Phe-Pro-Leu-Glu-Phe-Cys-Ser-Tyr-Ser-Met-Glu-His-Phe-Asp-Trp-Gly- Asp-Pro-Val-Gly-Pro-Asp-Ala-Gly-Asp-Gln-Pro-Val-Gly-Glu-Glu-Cys-Asp-Pro-Val-Glu-Val-Tyr-Pro-Asp-Ala | (C) Gly-Ser-Val-Arg-Asp-Pro-Val-Lys-Glu–Val-Tyr-Pro-Asp- Lys-Ala-Gly-Arg-Glu-Ser-Arg-Ala (a) Which of the three peptides would elute first from a gel filtration column? (b) Which of the three peptides would migrate the fastest on SDS-PAGE (c) Which of the three peptides could be…
- 2. | Calculate the overall charge (pH 7) on the following three polypeptides and answer the questions below. Assume the following pKa values: N-terminal -NH3®, 7.0; all -COOH groups, 4.0; Arg, 12.5; Cys, 8.4; His, 6.0; Lys, 10.0; Tyr, 10.0. (A) Ser-Tyr-Ser-Met-Glu–His–Phe–Arg–Trp-Gly-Lys-Pro–Val-Gly-Lys-Lys-Arg-Arg-Pro–Val-Lys-Val-Tyr-Pro-Asp-Ala -Gly- Glu--Asp-Gln- Ser-Ala-Glu-Ala-Phe-Pro-Leu-Arg-Glu-Phe (B) Ser-Tyr-Ser-Met-Glu-His-Phe-Arg-Trp-Gly-Ala-Pro-Val-Gly-Glu-Glu-Cys-Asp-Pro-Val-Glu-Val-Tyr-Pro-Asp- Ala-Gly-Glu-Asp-Gln-Ser-Ala-Glu-Ala-Phe-Pro-Leu-Glu-Phe-Cys-Ser-Tyr-Ser-Met-Glu-His-Phe-Asp-Trp-Gly- | Asp-Pro-Val-Gly-Pro-Asp-Ala-Gly-Asp-Gln-Pro-Val-Gly-Glu-Glu-Cys-Asp-Pro-Val-Glu-Val-Tyr-Pro-Asp-Ala (C) Gly-Ser-Val-Arg-Asp-Pro-Val-Lys-Glu–Val-Tyr-Pro-Asp- Lys-Ala-Gly-Arg-Glu-Ser-Arg-Ala 11. - - I C'IL- - 1! (e) Which of the above peptides would elute last from a gel filtration column? (f) Which of the three peptides would migrate the slowest on SDS-PAGE (g) Which of the three…Name the nucleosides or nucleotides. HOCH 2 OH HOCH 2 OH -20 POCH2 OH `N OH N NH₂ -Н N NH₂Match the following nucleobases (designated AD) with their names and answer questions about them. NH, NH, C D NH2 Note that some of the items from the answer list should NOT be used. Guanine 1. Aand B - Cytosine 2 Cand D • Adenine 3. Not shuwn v Thymine 4. D v Uracil 5. B a Aand C v Which of tho shown bases are pyrimidines? 7. A and O v Which of the shown bases form canonical A-T Watson-Crick base pair? S. A v Which of the shown bases form canonical G-C Watson.Crick base-pair? 9. Band C 10. C 11. Band D
- 2. | Calculate the overall charge (pH 7) on the following three polypeptides and answer the questions below. Assume the following pKa values: N-terminal –NH3®, 7.0; all -COOH groups, 4.0; Arg, 12.5; Cys, 8.4; His, 6.0; Lys, 10.0; Tyr, 10.0. (A) Ser-Tyr-Ser-Met-Glu-His-Phe-Arg-Trp-Gly-Lys–Pro–Val–Gly–Lys–Lys–Arg-Arg-Pro-Val-Lys–Val-Tyr-Pro-Asp-Ala -Gly- Glu-Asp-GIn– Ser-Ala-Glu-Ala-Phe-Pro-Leu-Arg-Glu-Phe (B) Ser-Tyr-Ser-Met-Glu-His-Phe-Arg-Trp-Gly-Ala-Pro-Val-Gly-Glu-Glu–Cys-Asp-Pro-Val-Glu–Val–Tyr-Pro-Asp- Ala-Gly-Glu-Asp-Gln-Ser-Ala-Glu-Ala-Phe-Pro-Leu-Glu-Phe-Cys-Ser-Tyr-Ser-Met-Glu–His-Phe-Asp-Trp-Gly- Asp-Pro-Val-Gly-Pro-Asp-Ala-Gly-Asp-Gln-Pro-Val–Gly–Glu-Glu-Cys-Asp-Pro–Val-Glu–Val–Tyr-Pro-Asp-Ala (C) Gly-Ser-Val-Arg-Asp-Pro-Val-Lys-Glu-Val-Tyr-Pro-Asp- Lys–Ala-Gly-Arg-Glu-Ser-Arg-Ala (d) Which of the three peptides would migrate the closest to the anode in isoelectric focusing? (e) Which of the above peptides would elute last from a gel filtration column? (f) Which of the three…H2N 1.) Look carefully at this nucleotide: N: N- Но-Р-О OH a.) Number the carbons in the sugar group. (Remember the "prime" symbols.) b.) Is this a purine or a pyrimidine? How do you know? c.) Would this nucleotide be used for DNA or RNA? How do you know? (Be specific.) d.) Is this nucleotide ready to be used for DNA replication or RNA transcription? Why/why not? e.) If this nucleotide were incorporated into a growing DNA or RNA strand, where would the next added nucleotide be attached to this one?6-One method to determine proximity of two locations in a protein molecule or protein complex is FRET. This technique uses fluorescence transfer between two fluorophores where the ability of the transfer to occur is correlated to distance between the two residues. A) On the following graph using colored pencils, pens, or markers draw the emission spectra from the donor and the absorbance spectra of the acceptor (this should be a general schematic, does not need to be a FRET pair). Include a key for your graph B) As a rescarch student in my group you want to study the proximity of two residues in clamp region of a protein. Draw a schematic of your protein and label the two locations of your fluorophores. In 2-4 sentences (or figures) explain how your FRET fluorophores would give determine if these two residues were close to one another.
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)