A protein has a number of aspartyl and gluatmyl residues, what would be the expected pl for this protein? 4 a O b. OC. Od Neutral pl Acidic pl Cannot be determined. Basic pl

Q: 4. For the dipeptide Ala-Cys given below: „SH H,C H.N. LOH Ala-Cys dipeptide a. Draw a dingram of…

A: The isoelectric point of a protein is defined as the pH at which the net charge of a protein…

Q: OH HO HO A NH2 Но. HO R-O. HO. HO HO R-O, OH Но HO `OH OH Но R-O, D HO. но но HO Но `OH OH B но. `OH…

A: Glycosidic bond is a type of covalent bond formed after reaction between hydroxyl group of…

Q: Using proper convention, provide the amino acid sequence for the following protein. _8_#_H²-8-8° CH3…

A: There are twenty standard amino acids that makeup all the peptides and proteins inside the cell.…

Q: 3. Estimate th spherical

A: Introduction: Amino acids make up the macromolecule known as protein. Proteins are essential for…

Q: You are treating your bacteria with an antibiotic that binds to the D-ala-D-ala stucture of the…

A: Antibiotics kill or inhibit the growth of bacteria. They function by focusing on specific components…

Q: 8) When a protein is not functional, it is said to be (1pts) denatured O recalibrated Oallocated O…

A: The building blocks of protein molecules are called amino acids.  They are very small organic…

Q: proteins? a. High pressure drives protein conformational equilibria towards the physically larger…

A: Protein  denaturation is the process in which the proper structure of the protein which is either in…

Q: a). What is the percentage alpha helical content of the protein? Show your working. b.) The protein…

A: Circular dichroism is a spectroscopic technique to find out the secondary structure, folding and…

Q: Glutamine is a conservative replacement for asparagine in the primary s mplies that Gln has a…

A: Aspargine and glutamine are amino acids with polar side chain. They are not charged. They have amide…

Q: Identify if the following property is applicable to ALL the 20 standard amino acids: Insoluble in…

A: All amino acid have similar backbone structure of basic amino group (−NH2), and an acidic carboxyl…

Q: 1. Please come up a peptide sequence for the two proteins shown in the diagram. Multi-pass protein…

A: The proteins shown in the diagram are single-pass protein and multi-pass protein, they are generally…

Q: 1) Therapeutic proteins such as human insulin are produced on a large scale in E. coli, however the…

A: Therapeutic insulin is produced as a result of heterologous gene expression in E. coli. E. coli is a…

Q: CH3CO-ETATKAELLAKYEATHK-CONH2 4. A polypeptide comprised of 17 amino acid res- idues with the…

A: Polypeptide: These are chains of amino acids with peptide bonds that connect them. Dehydration of…

Q: 3. Below is the structure of a nucleotide triphosphate. of of of O ATP R-O- R-O O R-O O O O O +|| O…

A: Nucleotides are organic molecules that form the basic building blocks of nucleic acids (DNA and…

Q: A. What type of bond is ( the two mark wtih questions mark) B. What special amino acid side chain…

A: Proteins  Proteins are the biological compound which is formed by the process of translation. They…

Q: An amino acid that would be categorized as negatively-charged due to its side chain is shown in…

A: Amino acids are biomolecules that have a hydrogen, a carboxyl group, an amino group and a chemically…

Q: 1. Name and draw the structures of standard amino acids that would likely form hydrogen bonds with…

A: Protein structures are stabilized by covalent and non-covalent bond. Covalent bond include peptide…

Q: Predict the secondary structure of a protein based on the sequence EAMNQKQFDRLHAEGAKWR. Explain your…

A: Ans..   When the amino acid are joined together, they formed the peptide chain. After the further…

Q: 27.Arginine is the most basic of the 20 amino acids because its side chain is most cells conditions.…

A: Amino acids are the monomers of proteins. These are the molecules that contain both amino and…

Q: Addition of _____ to a multi-subunit protein would involve the breaking of  covalent bonds a.…

A: Proteins have different levels of conformations. They are, primary structure, secondary structure,…

Q: Which one is not an example of supersecondary structure? the pyrrole ring O the Greek key the…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: A group of biologists developed a drug that target a specific protein and inhibit its function. This…

A: Proteins (polymers) are polymer composites of amino acid subunits (the monomers), and there are 20…

Q: Make a comparison between the teasons for the different flexibility that proteins that consists…

A: The objective of this question is to compare the reasons for the different flexibility of proteins…

Q: Based on the given blosum matrix, which 2 amino acid would most likely be found in place of val? Why…

A: SCORING MATRICES: In an alignment, a scoring system is a collection of values used to validate the…

Q: unfold the protein

A: Protein are consist of polymers of amino acids linked by amide/peptide bonds, which is called as…

Q: I. Proteins which fail to fold correctly are generally degraded by proteases. II. Chaperones convey…

A: Protein folding process - This process is mainly carried out with the help of 4 stages which are as…

Q: Identify and match the lettered regions in the titration curve of a basic amino acid. pic 5.jpg…

A: Histidine is an amino acid that has an imidazole ring as the functional group (R group). Thus, the…

Q: 7 Monomeric protein A reacts with an excess of 2-mercaptoethanol and gives protein B. The latter…

A: Certainly! Let's discuss the queries pertaining to the provided protein structures and reactions:…

Q: if i have protein with 110kda and its cysteine joining with disulfide bond . and one cysteine acids…

A: A chemical bond is a force of attraction between atoms or ions. Bonds form when atoms share or…

Q: 9. Use pKa values from the table to calculate isoelectric points for these three amino acids. CH3 NH…

A: Amino acids contain atleast two ionizable groups-the alpha carboxylic acid group and the alpha-amino…

Q: structure, The functional structure of a protein is its' which is ultimately determined by the 23.…

A: The human body is a complex and well coordinated assembly of organ systems and tissues. All of these…

Q: sheets are less likely to form than α helices during the earliest stages of protein folding. Explain…

A: The stability of the Alpha helix is affected by the electrostatic repulsion between amino acid…

Q: In the Procedure, you were instructed to use your original mixture of phycocyanin and 0.10 M sodium…

A: Buffers are compounds that can resist changes in pH, allowing the protein to remain in its…

Q: Identify if the following property is applicable to ALL the 20 standard amino acids: Asymmetric,…

A: Solution   A molecule that has no planes of symmetry is called asymmetric molecule.   A chiral…

Q: Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic…

A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If…

Q: protein, X, showed only one peptide band in native PAGE at pH 5 and 8.5. When the protein was run in…

A: Gel electrophoresis is used to separate macromolecules like DNA, RNA and proteins. DNA fragments are…

Q: ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser…

A: Complementary strand of RNA is formed by complementary base pairing that occurs between adenine and…

Q: 7. Imagine you're purifying a protein with a pl of 6.5 that has a 6-Histidine tag from E. coli…

A: Ni-NTA agarose is an affinity chromatography matrix that is used for the purification of recombinant…

Q: What is the overall charge on peptide  AVGDWESKELLE at pH 7.0? a. -3 b. -2 c. 0 d. +1   Which of…

A: The overall charge on a peptide depends upon the charge of the functional group like NH2 group, COOH…

Q: Wild type SSL2 reference sequence from amino acid 621 through 680 621 Lys Met Gly Lys Pro Phe Ile…

A: The term "Mutation" can be defined as the random and sudden inheritable changes in the DNA sequence…

Q: Amino Acids Cys A lanine |-CH2 SH Leucine Isaleucine Leu Ser Aspartil acia Gly Ser Leu Serine…

A: Amino acids are the building blocks of proteins. These are identified by their names or a…

Q: at punctures the bacterial cell wall has just been recently isolated from the F the peptide reveals…

A: Trypsin cleave on the carboxy side of arginine and lysine residues. Chymotrypsin cleave on the…

Q: Mass spectrometry and X‑ray diffraction are common biochemical techniques for characterizing…

A: In order to determine the mass-to-charge ratio (m/z) of one or more molecules found in a sample,…

Q: 4. Below is data obtained for an unknown protein's dihedral angles. Each dot represents the dihedral…

A: The peptide backbone can rotate about 2 bonds. The N-Cα bond that generates the φ angle and the Cα…

Q: c. Label each amino acid as polar, non-polar, or electrically charged d. Label the N-terminus and…

A: Introduction Amino acids are the building blocks that adjoin together by a peptide bond to form a…

Q: The vast majority of structures deposited in the Protein Databank (>95%) have been determined using…

A: Structural biology combines molecular biology, biochemistry, and biophysics tools and ideas to…

Q: Make a comparison between the teasons for the different flexibility that proteins that consists…

A: The objective of the question is to compare the reasons for the different flexibility of proteins…

Q: 4. Show exactly which peptide bonds you would expect trypsin to cleave if you set a digest with the…

A: Enzymes are protein molecules that increase the rate of biochemical reactions. Trypsin is an enzyme…