Does this source pass the CRAPP test? In what way? https://www.proquest.com/docview/2920273107/fulltext/CB6D343904E24855PQ/1?accountid=35779&sourcetype=Scholarly%20Journals
Q: Plz solve this question
A: for part i: Deoxygenated blood flows from the body to the heart through the vena cava (D).The heart…
Q: In a field study in a woodland ecosystem in the Serengeti region on the border of Tanzaniaand Kenya,…
A: Approach to Solving the Question: 1. For part (a), the approach is to simply add the number of…
Q: Which disorder does the image illustrate? Angioedema Oral candidiasis. Systemic sclerosis Systemic…
A: Option Angioedema: This option is incorrect because, marked by sudden, noticeable swelling in the…
Q: Why does adding salt to water decrease its freezing point? Group of answer choices Salt has a…
A: Adding salt to water decreases its freezing point due to a process called freezing point depression.…
Q: 1. Now make a model of the bank robber's genes on the chromosome. Place the gene for the bank…
A: I can explain the concepts behind the instructions and the use of DNA fingerprinting in solving…
Q: None
A: To accurately solve the problem, we need to follow the following procedure and calculate the number…
Q: Can you help me combine all the ideas I have written down into a cohesive topic related to the…
A: Approach to Solving the Question:To effectively address the research topic on the cardiovascular…
Q: in text form with proper workings and explanation for each and every part and steps with concept and…
A: 1. Comparison of Molluscs and Jellyfish Why Molluscs are Considered More Complex than JellyfishBody…
Q: Why do temperatures generally vary less in the Southern Hemisphere than in the Northern Hemisphere?…
A: Temperatures generally vary less in the Southern Hemisphere than in the Northern Hemisphere because…
Q: Please help Name of 2 protists What form of motility do they use? Describe the environment they…
A: Let's discuss the answers further. Paramecium caudatum:This protist moves using cilia, which are…
Q: Shown below is a set of cell culture plates for a plaque assay. The assay was performed by…
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: Please siiir, I want you to explain to me what this symbol means in this context? I don't want u to…
A: If you have any questions let me know in comment box thankyou for your question.
Q: Key Label the parts of the heart Blood flow h). d) aorta right atrium right ventricle inferior vena…
A: Left Ventricle was added because there is no left ventricle but it has two right ventricles.b -…
Q: An individual is found unconscious and is admitted to the hospital with heroin overdose. Which…
A: When an individual is found unconscious due to a heroin overdose, the immediate priority is to…
Q: Two species of fish live in the Pacific ocean. The first species, Bigous fishis, can only live in…
A: In ecological terms:Niche: The role or function of an organism or species in an ecosystem, which…
Q: When assisting the client with inhaled medication the right positioning of the client is the key.…
A: The Importance of Proper Positioning in Administering Inhaled MedicationsAdministering inhaled…
Q: Can you turn these words into the topic to write for a paper? Note: Only topics, no additional…
A: The Role of Bacteria in Chickenpox Infection:This topic could explore the potential involvement of…
Q: Draw a generic (+)RNA virus replication cycle. For viruses, (+) RNA indicates the genomic RNA can…
A: Proteins and FunctionsThe enzyme known as RNA-dependent RNA polymerase (RdRp) creates new (+) RNA…
Q: None
A: Water molecules tends towards to each other due to cohesive forces, which forms a surface tension…
Q: Imagine you have 3 separate plots each seeded with 3 species, a ruderal, a competitor, and a stress…
A: Detailed explanation: Plot A is desert-like with a harsh but stable environment - Stress Tolerators…
Q: Which order does rhizoid belong to?
A: Bryophytes (mosses, liverworts, and hornworts):Rhizoids are present in all classes within this…
Q: What are the differences between sodium-potassium exchange pump and sodium-glucose transporter?…
A: Detailed explanation: 1) The Sodium-Potassium Exchange Pump (Na+/K+ ATPase) and the Sodium-Glucose…
Q: take all of this information and turn it into a topic Note: make sure that it is a topic; no…
A: Blood is composed of various components that each have important functions in the body. Red blood…
Q: The level of this hormone exhibits circadian variation ○ Adrenalin Cortisol ○ Insulin ○ Glucagon ○…
A: Cortisol is the hormone that exhibits circadian variation. Its levels fluctuate throughout the day,…
Q: What is the importance of freshwater wetlands? Group of answer choices They are a great defense…
A: Let's delve into the detailed explanation for each of the choices regarding the importance of…
Q: Place Piaget’s periods of cognitive development in order. Concrete Operations Formal…
A: Jean Piaget, a Swiss psychologist, proposed a theory of cognitive development that explains how a…
Q: Which of these models correctly identifies the most recent common ancestor diploblasts? Cnidaria…
A: The image presents 4 different phylogenetic models that depict the evolutionary relationships among…
Q: None
A: The first question is:You will be asked to take measurements of the circumference of all of the…
Q: Use the Florida Plant Atlas to complete a search for Bryophytes. (Use the video in the content area…
A: To complete the table for Bryophytes in Broward County using the Florida Plant Atlas, follow these…
Q: Does this source pass the CRAPP test? In what way? https://www.apa.org/topics/mindfulness/meditation
A: The CRAPP test is a method to evaluate the credibility and reliability of a source. CRAPP stands for…
Q: None
A: To determine which mode of inheritance does not apply to the given pedigree, let's analyze each mode…
Q: Match the following: Mitochondria Turns light from the sun into energy…
A: Approach to solving the question:To match the organelles with their functions, I relied on my…
Q: None
A: Pullulan: Unveiling its Similarities and Differencesa) A Structural Twin: AmylopectinAmong the…
Q: INVESTI-BANK LaB-AIDS INCORPORATED 11:35 AM December 17 DANT 1271SC35
A: The first image depicts a group of armed gang robbers in INVESTI-BANK on December 17 around 11:35…
Q: If a man with type O blood has a child with a woman who is heterozygous for type A blood, what are…
A: Blood type is determined by the presence or absence of certain antigens on the surface of red blood…
Q: None
A: Initial Conditions: We start with a 20% nicotine solution in water at 25°C.Heating to 120°C: The…
Q: Compare the forelimb anatomy of the ancestor (left) to the anatomy of other vertebrate relatives…
A: The common ancestral bones are U for ulna, M for metacarpals, P for phalanges, R for radius, C for…
Q: The Mexican spotted owl and the Northern spotted owl used to be the same species. They were…
A: The Mexican spotted owl and the Northern spotted owl are an example of allopatric speciation.…
Q: What is the effect of water’s viscosity on aquatic organisms? Group of answer choices It increases…
A: Option a: This option is incorrect because the difference in density between an object and water…
Q: Cómo se llama la especie inventada vive en el futuro salvaje y era descendiente del la gacela
A: Detailed explanation:The species you are thinking of is probably the "Gigantelope." They are…
Q: Structures that are unique to plant cells include which of the following? mitochondria and cell…
A: The question is asking us to identify the structures that are unique to plant cells. This means…
Q: Project on genetic disorders class 12
A: What are Genetic Disorders?Imagine the blueprint for a building. A slight change in that plan, like…
Q: We are bombarded with nutrition and health claims through all kinds of media every day. What are…
A: The use of buzzwords and claims in the food and wellness industries is a widespread practice that…
Q: Case Study Armando Reyes Armando Reyes (preferred pronouns he, him) is a healthcare professional…
A: All of the immunizations you listed are recommended during the toddler years:Haemophilus influenzae…
Q: A B C D E F G DEFG Which of the following forms a monophyletic group? (see figure) D, E, and F E, F,…
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: Capsaicin, the active ingredient in hot peppers, creates a burning sensation because it destroys…
A: Capsaicin, the active ingredient in hot peppers, creates a burning sensation because it binds and…
Q: Decline of grey wolf populations in the US northwest in the early 1900s resulted in ______ of elk…
A: In the early 1900s, the decline of grey wolf populations in the US northwest was primarily due to…
Q: Which intervention would the nurse use to promote the safety of a client experiencing alcohol…
A: Alcohol withdrawal is a condition that occurs when a person who has been drinking excessive amounts…
Q: If you were asked to provide the U.S. Surgeon General with ways in which Americans could achieve…
A: Achieving public health objectives in the United States requires a multifaceted approach that…
Q: 1. What is the scientific method and why it's important? Explain about the pros and cons of the…
A: The scientific method is a systematic approach used in scientific studies to gather data, formulate…
Does this source pass the CRAPP test? In what way?
https://www.proquest.com/docview/2920273107/fulltext/CB6D343904E24855PQ/1?accountid=35779&sourcetype=Scholarly%20Journals
Step by step
Solved in 2 steps
- personal/eenongen_my_tnstate_edu/_layouts/15/doc.aspx?sourcedoc={a6b083c9-a226-4c31... O Search (Option + Q) Review View Help Editing v A BI U Ov =<=v 三 v ... Question 13 Zinc finger nuclease is a Gene editing tool: which uses a site-specific endonucleases containing a DNA-cleavage domain and a modular DNA-binding domain RNA-guided endonucleases programmable nucleases Exonuclease Question 14 Which elements are required for DNA to behave as a chromosome in yeast cells: a centromere an autonomous replicating sequence two telomeres Antibiotic selection marker Question 15 A series of such clones where the insert of each clone partially overlaps that of its neighbors with no gaps is known as a Clone Contig DNA fingerprinting A tiling path Genome MacBook ProSearch (Option + Q) rences Review View Help Editing v A^ Dv A A A Question 1 During nucleic acid hybridization, the probe is labelled for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification Question 2 10 IV 12 13 14 Which of the following best describes the trait in the pedigree? Question 2 options: X-linked dominant X-linked recessive autosomal domiant autosomal recessiveוןווד ← Q Lab Report 6 worksheets 314 F22 .DOCX File Edit View Insert Format Tools Help A 100% ¿ Summary Grades for Arysta Visser: 23 x M Uh-oh! There's a problem w X b The restriction EcoRI cleaves X + Untitled spreadsheet - Goog X https://docs.google.com/document/d/1mKY1HIgMPRh1kRDCmX7msBF2yf07-ogT/edit Outline Headings you add to the document will appear here. Normal text Times ... 12 + B I U 2 18. The restriction EcoRI cleaves double-stranded DNA at the sequence 5'-GAATTC-3', the restriction enzyme HindIII cleaves at the sequence 5'-AAGCTT-3', and the restriction enzyme BamHI cleaves at 5'GGATCC-3. An 805 bp circular plasmid is digested with each enzyme individually and then in combination, and the resulting fragment sizes are determined by means of electrophoresis. The results are as follows: 1 Restriction Enzyme(s) EcoRI BamHI HindIII EcoRI and BamHI EcoRI and HindIII BamHI and HindIII 3 Practice ====•=•€ EX Fragment lengths (base pairs) 430 bp, 375 bp 470 bp, 335 bp Lab Report 6…
- The sequence shown in Figure 2 is the nucleotide sequence of a heat shock protein of Bacillus anthracis obtained from the NCBI database. >NC_005945.1:2107825-2108262 Bacillus anthracis str. Sterne chromosome ATGCGTAATTTATTTCCAGAAATAACAAAACGTCAAAATGGTATTTTTGATTTTGGACCTTCTTTATTAG AAGGGATGACAGATGCTTTCTTTAAACCGATGAACATGGATATTTTTAAAGTAGATGTTCATGAACAATC TGATAAATATACAGTGAAAGCAGATTTACCAGGTTTTCAAAAAGAAAACATTCAAGTTGAATTTGAACAA GATGTATTAACGATTCAAGCAACTAATCATAATGAAGTAGAAGAAAAAAATGAGAATGGCACATATATTC GTAAAGAACGTTCTATAGGTTCTGTAACTCGACGTTTTAGTTTTAAACAAGTTGAGGAAGAAAATGTTAG AGCGAATTACAAAGATGGCGTGTTGACAATTGAATTGCCAAAATTGAAAGAAGAAAAAAACAGTAAAACA ACAATTAATATTGAATAA Figure 2 (i) Is the nucleotide sequence above translatable into a complete protein? Justify your answer. (ii) Is the sequence above represented in the standard FASTA format? Explain your answer.ule_2023_Spring_Stu x M Inbox (1) - Ic21-0506@lclari X =6104_EP#6 - Google Docs ent/d/104sNODGApfrUg768nDS9piPmOB-VzXs86b_t-tDcDF8/edit My Drive - Google... WebAdvisor Main... ols Extensions Zotero Help text T Arial Haplontic life cycle Diplontic life cycle Parthenogenesis Karyotype Histone - 11 + 2 4. Match the words with the correct definitions: | Alternation of generations Job Listing - USF... WT Enrollment Requir... B I U 3 4 X 0 Lecture Video: The Cell Cyc x Chemical Principl... UO UND Orn Z = - 1:3 A type of reproduction that produces a clone of the mother A protein DNA wraps around it to condense the DNA An organism alternates between 1n and 2n with each generation A complete set of chromosomes, as they appear in the nucleus When an organism spends most of its life in the 1n state When an organism spends most of its life in the 2n state 11Anglaauk/courses/ 16967/external tools/retrieve?display full width&url=https 1962F2Fcanys-anglia-a ukquiz-Iti-dub pp-g-zinb Re Using the class data below (where the results shown are the averages obtained from each set of individual data; also on practical schedule), find the mean mitotic index for Allium cepa. Please give your answer correct to 2 decimal places (just add the number, with no units). Table 2. Total number of cells in a field of view of Allium cepa, with numbers of cells in prophase (P), metaphase (M), anaphase (A) and telophase( T) Total M A 141 15 3 2 145 21 4 3 146 9 146 13 7 7 5 146 25 11 5 2 147 13 7 5 150 15 10 10 4 154 24 12 3 155 27 11 7 159 25 19 6. 160 22 11 161 16 14 7 166 24 171 18 2 6. 172 25 5 5 6. 175 15 6. 4 2. 177 27 14 7. 5 179 14 10 180 28 2 191 13 4 1. 1 194 12 3. 3 Tvne vour answer 8°C Mostly cloudy A O 4) search 99+ 近
- 132624252274557919.docx (Protected View) - Word Safa Mushtaq File Home Insert Design Layout References Mailings Review View Help O Search A Share A PROTECTED VIEW Be careful-files from the Internet can contain viruses. Unless you need to edit, it's safer to stay in Protected View. Enable Editing (b) Following figure is showing the DNA fingerprint analysis on the one locus of a man with four children. Which lane contains the DNA of a father? Why did you select that lane? 1 4 A Page 1 of 2 454 words 130% 8:25 PM G A ENG 4/9/2021e- e.com/student/studentformative/ Online Tools Juan Bonilla Velasquez > Nimitz 20-21: CA Biology ProSyn & Mum Previous Question 13 Next Question 13 (2015 6E) In the 1960s the molecular biologist George Streisinger developed the strand-slippage hypothesis. Streisinger noticed that mutations occurred in areas of DNA that contained many repeated sequences. When a strand-slippage error occurs, an insertion mutation can result. How does the insertion mutation affect the DNA? Answer A Nitrogenous bases are added. B Nitrogenous bases are exchanged. C Nitrogenous bases are damaged. D Nitrogenous bases are deleted. Question 13 Next nologies Inc 2021- Edugence Sign outersonal/eenongen_my_tnstate_edu/_layouts/15/doc.aspx?sourcedoc={a6b083c9-a226-4c31... ☆ Search (Option + Q) Review View Help Picture Editing A В ... During nucleic acid hybridization, the probe is labelled Question 1 options: for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification Question 2 6. 9. 10 IV 13 14 Which of the following best describes the trait in the pedigree? Question 2 options: X-linked dominant X-linked recessive autosomal domiant autosomal recessive ON
- Draw the Haworth projection of B-L-altrose. You will find helpful information in the ALEKS Data resource. Explanation 2 Check # 3 Click and drag to start drawing a structure. $ 4 % 5 80 6 :: & 7 X S * 00 to v © 2023 McGraw Hill LLC. All Rights Reserved. Terr ( 9* Le TH Sa u GWG AA PE x GWB Bi 31 K S. .com/forms/d/e/1FAlpQLSeRQOhizlj9haFIAG8XZwqYqNjd4lzDAumrUT8-Azr5lcf77g/viewform?hr_ submission=Chkl14ORirMBEhA e A 33rd Period 10th Gr... Maps H Mail - SC458917 -.. A 33rd Period 10th Gr.. E Applied Educationa.. A To-do A researcher uses a logistic model of population growth. Which statement best describes the relationship between time and population size in a logistic growth model? Over time, population size increases without limit. Over time, population size increases and then levels off to a maximum value. Over time, population size decreases and then levels off to a minimum value. Population size is not related to the passage of time. As limiting factors, how do disease differ from a forest fires? thing 1O DELLDescribe the Lidcombe program.