Does this source pass the CRAPP test? In what way? https://www.proquest.com/docview/1788524207/fulltext/68562C56954E411EPQ/1?accountid=35779&sourcetype=Scholarly%20Journals
Q: Canada lynx are predators of snowshoe hares. Which of the following represent density-dependent…
A: Density-dependent limitations are factors that affect a population's size and growth depending on…
Q: ab ab Class 2:5 tetrads The Class 2 tetrads are: a. Parental ditype b. Non-parental ditype. c.…
A: Approach to solving the question: Detailed explanation: tetratype is a tetrad containing two…
Q: Natural selection typically favors mechanisms that prevent the accumulation of DNA defects in…
A: Mechanisms that prevent the buildup of DNA abnormalities in animals with high survival rates are…
Q: None
A: Solution:The most relevant choices are: b and c(In case only one choice is required- then option B…
Q: There are marked differences in the type of organisms found at four different locations at the same…
A: The differences in the type of organisms found at different locations along a rocky shore, even at…
Q: D Question 1 Which monomer is used in the forming the following polymer? ΟΙ Oll O III SO IV CI CI CI…
A: Option I: This option is incorrect Option II: This option is incorrect Option III: This option is…
Q: A middle adult presents to the clinic for immunizations. Assuming all previous recommended vaccines…
A: The question is asking which vaccines a middle-aged adult should receive, assuming they have already…
Q: +…
A: An animal with an irregular shape that cannot be divided into two equal halves has asymmetry.When an…
Q: Case Study: Katherine Katherine A healthcare professional is caring for Katherine, an older adult,…
A: First, let's understand Katherine's health conditions. She is at risk for osteoporosis, has high…
Q: Plz solve this question
A: for part i: Deoxygenated blood flows from the body to the heart through the vena cava (D).The heart…
Q: Place Piaget’s periods of cognitive development in order. Concrete Operations Formal…
A: Jean Piaget, a Swiss psychologist, proposed a theory of cognitive development that explains how a…
Q: None
A: The chemical structure depicted in the image is an intricate bicyclic compound, characterized by its…
Q: None
A: Here's why:Nucleic acid hybridization: Binding complementary base sequenced strands to each other to…
Q: Which type of brain tumor can originate from cells that form the myelin sheath around nerves?…
A: The question is asking us to identify which type of brain tumor originates from the cells that form…
Q: Biology Question
A: It seems you have uploaded an image of a footprint on paper. Can you provide more details about what…
Q: In a population of flowers, there is variation in petal size, with some flowers having very small…
A: Option a: This option is correct because extreme features are less common in populations where…
Q: Which of these questions is included on the CAGE screening test for alcoholism? "Do you feel that…
A: The CAGE questionnaire is a widely used method of screening for alcoholism. The acronym CAGE stands…
Q: When assisting the client with inhaled medication the right positioning of the client is the key.…
A: The Importance of Proper Positioning in Administering Inhaled MedicationsAdministering inhaled…
Q: Spiny species of diatoms are found in both warm subtropical waters and colder areas. Because warm…
A: Diatoms are a type of algae that are known for their unique cell walls, or frustules, which are made…
Q: In insects, primary symbionts are ________, while secondary symbionts are ________. able to…
A: Option 1 is incorrect because primary symbionts cannot replicate outside of the host and secondary…
Q: Please convert each of the following words into topics for a paper. Make sure each topic is related…
A: Skin Color and Related ConditionsVitiligoVitiligo is a chronic skin condition characterized by the…
Q: None
A: Approach to solving the question: Analyze the question. Detailed explanation:Here's an explanation…
Q: Can you help me with this research paper topic? chronic obstructive pulmonary disease research…
A: Title:The Impact of Chronic Obstructive Pulmonary Disease on Quality of Life IntroductionChronic…
Q: Pick all that are true and none that are false. Climate change could influence pathogenic disease…
A: 1.a. Warmer temperatures and microbial growth rates:Microbial Growth Rates: Microorganisms such as…
Q: Why do temperatures generally vary less in the Southern Hemisphere than in the Northern Hemisphere?…
A: Temperatures generally vary less in the Southern Hemisphere than in the Northern Hemisphere because…
Q: Periods and Life Stage Select the correct level of moral development to match the corresponding…
A: The theory of moral development is a framework proposed by psychologist Lawrence Kohlberg to explain…
Q: If you can It is important to include all the necessary details about the course context and provide…
A: What is the Detailed Anatomy of the Heart?The heart is a highly specialized, muscular organ…
Q: QUESTION 5 You plan to run a standard curve of BSA to determine the concentration of protein in an…
A: Step 1:Step 2:Step 3: Hope this helps!
Q: QUESTION 2 2.1 10-C The figures below shows two leaves from the same plant B A (12) 2.1.1 Suggest…
A: Key references:Brestic, M., Zivcak, M., Vysoka, D. M., Barboricova, M., Gasparovic, K., Yang, X.,…
Q: In a coastal marine habitat, a species of fish is found. During the breeding season, dominant males…
A: Based on the details provided about the breeding behavior of the fish species in the coastal marine…
Q: A guardian is playing with an infant using a colorful ball. At three months of age, the guardian hid…
A: The sensorimotor stage is the first of the four stages proposed by Jean Piaget to describe the…
Q: Which of the following scenarios best illustrates Liebig's Law of the Minimum? Group of answer…
A: Liebig's Law of the Minimum states that the growth of an organism is limited by the scarcest…
Q: Which of the following examples is the only one to likely be under the influence of natural…
A: In the process of natural selection, changes within a population that have an impact on an…
Q: None
A: Changes in DNA sequence: This option is correct because epigenetic changes do not involve…
Q: I been having a hard time finding a an article related to Gene Linkage. That have these requirments.…
A: First, let's understand the requirements. You are looking for a peer-reviewed journal article…
Q: If a man with type O blood has a child with a woman who has type AB blood, what are the possible…
A: Blood type is determined by the presence or absence of certain antigens (proteins) on the surface of…
Q: Theme () (عبد الرحيم هاشم أحمد الزغول Question 11 of 25 Reducing the number of microorganisms to a…
A: Out of the three options, only Disinfection refers to reducing the number of microorganisms to a…
Q: a) Explain how it can be the case that mutating a Homeobox containing gene has a large impact on the…
A: Homeobox genes are a group of related genes that control the body plan of an embryo along the…
Q: In a population of snails occupying a single small pond, some individuals possess a single sex, and…
A: To determine the order of these three reproductive strategies in terms of their relative fitness, we…
Q: ☐ Select the paraphyletic groups (indicated with color). (select all that apply) Reptiles Fishes…
A: A paraphyletic group is a group of any size and systematic rank that originated from a single common…
Q: Can you help me with this outline for my research paper? What I’m looking for in my outline is an…
A: Approach to solving the question:Read and understand the question.Analyze the question.Create an…
Q: GIVE detailed Solution. Don't use Ai for answering this
A: Step 1: The polyadenylation of the pre-mRNA sequences in eukaryotes occurs during which stage of…
Q: Medications have expiry date and must be reviewed every time before administering medication.…
A: TrueMedications have expiry dates and must be reviewed every time before administering medication.…
Q: 15. Denaturation of ß-lactoglobulin is strongly related so many funcitonal proportes of dairy…
A: 15. The effects of beta-lactoglobulin denaturation on the texture and solubility of yoghurt and milk…
Q: When a plant breeder crossed two red roses, 78% of the offspring had red flowers and 22% had white…
A: The observed results from the cross of two red roses, where 78% of the offspring have red flowers…
Q: None
A: In the diagram, label "C" points to one black arrow moving out of the circle. Since this diagram…
Q: Shown below is a set of cell culture plates for a plaque assay. The assay was performed by…
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: For each genotype, indicate whether it is heterozygous (HE) or homozygous (HO). AA _____…
A: In genetics, homozygous refers to the state or condition where an individual has inherited the same…
Q: All vertebrate animals have essentially the same skeletal morphology. This is ___________________…
A: The question is asking us to identify the type of evidence for evolution that is represented by the…
Q: What weather conditions are typically associated with the Intertropical Convergence Zone (ITCZ)?…
A: The ITCZ is a region near the equator where the trade winds from the Northern and Southern…
Does this source pass the CRAPP test? In what way?
https://www.proquest.com/docview/1788524207/fulltext/68562C56954E411EPQ/1?accountid=35779&sourcetype=Scholarly%20Journals
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- 132624252274557919.docx (Protected View) - Word Safa Mushtaq File Home Insert Design Layout References Mailings Review View Help O Search A Share A PROTECTED VIEW Be careful-files from the Internet can contain viruses. Unless you need to edit, it's safer to stay in Protected View. Enable Editing (b) Following figure is showing the DNA fingerprint analysis on the one locus of a man with four children. Which lane contains the DNA of a father? Why did you select that lane? 1 4 A Page 1 of 2 454 words 130% 8:25 PM G A ENG 4/9/2021personal/eenongen_my_tnstate_edu/_layouts/15/doc.aspx?sourcedoc={a6b083c9-a226-4c31... O Search (Option + Q) Review View Help Editing v A BI U Ov =<=v 三 v ... Question 13 Zinc finger nuclease is a Gene editing tool: which uses a site-specific endonucleases containing a DNA-cleavage domain and a modular DNA-binding domain RNA-guided endonucleases programmable nucleases Exonuclease Question 14 Which elements are required for DNA to behave as a chromosome in yeast cells: a centromere an autonomous replicating sequence two telomeres Antibiotic selection marker Question 15 A series of such clones where the insert of each clone partially overlaps that of its neighbors with no gaps is known as a Clone Contig DNA fingerprinting A tiling path Genome MacBook ProSearch (Option + Q) rences Review View Help Editing v A^ Dv A A A Question 1 During nucleic acid hybridization, the probe is labelled for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification Question 2 10 IV 12 13 14 Which of the following best describes the trait in the pedigree? Question 2 options: X-linked dominant X-linked recessive autosomal domiant autosomal recessive
- Anglaauk/courses/ 16967/external tools/retrieve?display full width&url=https 1962F2Fcanys-anglia-a ukquiz-Iti-dub pp-g-zinb Re Using the class data below (where the results shown are the averages obtained from each set of individual data; also on practical schedule), find the mean mitotic index for Allium cepa. Please give your answer correct to 2 decimal places (just add the number, with no units). Table 2. Total number of cells in a field of view of Allium cepa, with numbers of cells in prophase (P), metaphase (M), anaphase (A) and telophase( T) Total M A 141 15 3 2 145 21 4 3 146 9 146 13 7 7 5 146 25 11 5 2 147 13 7 5 150 15 10 10 4 154 24 12 3 155 27 11 7 159 25 19 6. 160 22 11 161 16 14 7 166 24 171 18 2 6. 172 25 5 5 6. 175 15 6. 4 2. 177 27 14 7. 5 179 14 10 180 28 2 191 13 4 1. 1 194 12 3. 3 Tvne vour answer 8°C Mostly cloudy A O 4) search 99+ 近The sequence shown in Figure 2 is the nucleotide sequence of a heat shock protein of Bacillus anthracis obtained from the NCBI database. >NC_005945.1:2107825-2108262 Bacillus anthracis str. Sterne chromosome ATGCGTAATTTATTTCCAGAAATAACAAAACGTCAAAATGGTATTTTTGATTTTGGACCTTCTTTATTAG AAGGGATGACAGATGCTTTCTTTAAACCGATGAACATGGATATTTTTAAAGTAGATGTTCATGAACAATC TGATAAATATACAGTGAAAGCAGATTTACCAGGTTTTCAAAAAGAAAACATTCAAGTTGAATTTGAACAA GATGTATTAACGATTCAAGCAACTAATCATAATGAAGTAGAAGAAAAAAATGAGAATGGCACATATATTC GTAAAGAACGTTCTATAGGTTCTGTAACTCGACGTTTTAGTTTTAAACAAGTTGAGGAAGAAAATGTTAG AGCGAATTACAAAGATGGCGTGTTGACAATTGAATTGCCAAAATTGAAAGAAGAAAAAAACAGTAAAACA ACAATTAATATTGAATAA Figure 2 (i) Is the nucleotide sequence above translatable into a complete protein? Justify your answer. (ii) Is the sequence above represented in the standard FASTA format? Explain your answer.וןווד ← Q Lab Report 6 worksheets 314 F22 .DOCX File Edit View Insert Format Tools Help A 100% ¿ Summary Grades for Arysta Visser: 23 x M Uh-oh! There's a problem w X b The restriction EcoRI cleaves X + Untitled spreadsheet - Goog X https://docs.google.com/document/d/1mKY1HIgMPRh1kRDCmX7msBF2yf07-ogT/edit Outline Headings you add to the document will appear here. Normal text Times ... 12 + B I U 2 18. The restriction EcoRI cleaves double-stranded DNA at the sequence 5'-GAATTC-3', the restriction enzyme HindIII cleaves at the sequence 5'-AAGCTT-3', and the restriction enzyme BamHI cleaves at 5'GGATCC-3. An 805 bp circular plasmid is digested with each enzyme individually and then in combination, and the resulting fragment sizes are determined by means of electrophoresis. The results are as follows: 1 Restriction Enzyme(s) EcoRI BamHI HindIII EcoRI and BamHI EcoRI and HindIII BamHI and HindIII 3 Practice ====•=•€ EX Fragment lengths (base pairs) 430 bp, 375 bp 470 bp, 335 bp Lab Report 6…
- Draw the Haworth projection of B-L-altrose. You will find helpful information in the ALEKS Data resource. Explanation 2 Check # 3 Click and drag to start drawing a structure. $ 4 % 5 80 6 :: & 7 X S * 00 to v © 2023 McGraw Hill LLC. All Rights Reserved. Terr ( 9Translation take place in _______ on a _____________.ule_2023_Spring_Stu x M Inbox (1) - Ic21-0506@lclari X =6104_EP#6 - Google Docs ent/d/104sNODGApfrUg768nDS9piPmOB-VzXs86b_t-tDcDF8/edit My Drive - Google... WebAdvisor Main... ols Extensions Zotero Help text T Arial Haplontic life cycle Diplontic life cycle Parthenogenesis Karyotype Histone - 11 + 2 4. Match the words with the correct definitions: | Alternation of generations Job Listing - USF... WT Enrollment Requir... B I U 3 4 X 0 Lecture Video: The Cell Cyc x Chemical Principl... UO UND Orn Z = - 1:3 A type of reproduction that produces a clone of the mother A protein DNA wraps around it to condense the DNA An organism alternates between 1n and 2n with each generation A complete set of chromosomes, as they appear in the nucleus When an organism spends most of its life in the 1n state When an organism spends most of its life in the 2n state 11
- e- e.com/student/studentformative/ Online Tools Juan Bonilla Velasquez > Nimitz 20-21: CA Biology ProSyn & Mum Previous Question 13 Next Question 13 (2015 6E) In the 1960s the molecular biologist George Streisinger developed the strand-slippage hypothesis. Streisinger noticed that mutations occurred in areas of DNA that contained many repeated sequences. When a strand-slippage error occurs, an insertion mutation can result. How does the insertion mutation affect the DNA? Answer A Nitrogenous bases are added. B Nitrogenous bases are exchanged. C Nitrogenous bases are damaged. D Nitrogenous bases are deleted. Question 13 Next nologies Inc 2021- Edugence Sign outIf a base was added or deleted and the reading frame shifted, this would be an example of a ___________________ mutation.I read the instructions but I don’t understand how to solve the data sheet.