DNA strand 1 (template) TACATGCTCGTGACTTTT Mutation in strand 1 TACATGTCGTGACTTTT DNA Strand 5 (template) TACAGGTGTTCCCAGATCGGG Mutation in DNA strand 5 TACAGGTGTTCCCATATCGGG 1.use the original (template) strand of DNA to find the correct amino acid sequence in the DNA. 2.find and highlight the mutation in the DNA. 3.Find the new sequence of the amino acids for the protein in the new mutated strand of DNA. 4.Determine if this mutation is a point mutation of a Frame shift Mutation. 5.Determine if it is a silent mutations, Missense mutation, Nonsense mutation, Insertion or Deletion. 6.will this new protein function the same as the old protein? Why or why not?
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
DNA strand 1 (template) TACATGCTCGTGACTTTT Mutation in strand 1 TACATGTCGTGACTTTT
DNA Strand 5 (template) TACAGGTGTTCCCAGATCGGG Mutation in DNA strand 5 TACAGGTGTTCCCATATCGGG
1.use the original (template) strand of DNA to find the correct amino acid sequence in the DNA.
2.find and highlight the mutation in the DNA.
3.Find the new sequence of the amino acids for the protein in the new mutated strand of DNA.
4.Determine if this mutation is a point mutation of a Frame shift Mutation.
5.Determine if it is a silent mutations, Missense mutation, Nonsense mutation, Insertion or Deletion.
6.will this new protein function the same as the old protein? Why or why not?

Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 2 images









