Directions: Analyze the climate graph and dětetmih for temperature and precipitation for that biome Tundra Climatogram I Precipitation (inches) Temperature (F) 00 (aradu

Q: 2) (recall) whlo is the coding one? A)UAG B)UGA C)UAA D) AUG E) none of the above 13)…

A: A codon is a trinucleotide sequence of DNA or RNA that corresponds to a specific amino acid.The…

Q: Cystic hibros Ife-threatering disease that causes thick, stcky mucus to buid up in areas of the…

A: DNA is the genetic material in living organisms that is transcribed into mRNA. This mRNA is used for…

Q: Orbit Frontal bone Occipital bone Sphenoid bone Suture 1 Temporal bone Nasal bone Maxilla Parieta…

A: Skull is the protective bony covering that protects the brain cavity and supports the face. It…

Q: What is the term for the edge of the leaf?

A: Note: Since you have asked multiple question, we will solve first question for you. If you want any…

Q: 2) What are 4 factors that can influence enzymatic activity? What influence does each factor have on…

A: Since you have asked multiple questions, we will solve the second question for you. If you want any…

Q: In some chickens, the gene that produces color shows incomplete dominance. The gene will produce…

A: Incomplete dominance is a form of intermediate inheritance in which one allele for a specific trait…

Q: Q1.32. In the terrestrial phosphorus cycle illustrated below, at what rate is the size of the plant…

A: Phosphorous is introduced into soil by the weathering of rocks. The soluble phosphorous is then…

Q: The study of biology includes things that were once living and those alive today. O True O False

A: This statement is TRUE.

Q: Much of what we understand about what different areas of the brain do comes from studying patients…

A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…

Q: When a true null hypothesis is rejected in a hypothesis test, the researcher or analyst has A.…

A: The collection of methods in biology known as "experimental biology" focus on using experimentation…

Q: I don't get it. I need help to explain to me

A: Mutation can be classified as small -scale or large- scale. In the concerned mutational phenomenon,…

Q: Select all that apply about 02 and CO2. O Both are nonpolar molecules. Both can diffuse passively…

A: The gases oxygen and carbon dioxide are critical components of the earth's atmosphere. This is…

Q: The net primary productivity of a temperate deciduous forest is approximately 180,000 kcal /m2 /…

A: In the ecosystem the producers are the organisms that can trap the solar energy and convert them…

Q: Of the choices below, the best definition of evolutionary fitness is: Ostrength the ability to adapt…

A: In the ecosystem different species interact with each other and also the individuals with same…

Q: I’m Spanish and I’m learning English. I received this email from my professor: I will be out…

A: It's a future tense in English  , yes ,  no class tomorrow .

Q: B lymphocytes holding knowledge of an infectious agent for future responses are called: a) helper…

A: Immune system acts as a defense system in our body by protecting from effects of pathogens and also…

Q: Which of the following enzymes breaks down fats? * amylase Olipase Omaltase trypsin A plant vacuole…

A: The human body is a sophisticated, meticulously planned system made up of individual cells which…

Q: Describe the level organization in the human body What are carbohydrates, lipids, and proteins, and…

A: Life processes of the human body are kept up with at a few levels of structural organization. The…

Q: Select the functions of blood. It produces hormones that coordinate body activities. It generates…

A: Blood:  Blood is a bodily fluid found in humans and other animals that transfers metabolic waste…

Q: 2', 3'-Dideoxyinosine has been approved as an anti-HIV drug. Propose a mechanism by which it might…

A: The management of HIV/AIDS normally includes the use of multiple antiretroviral drugs in an attempt…

Q: B- E 36. Identify the indicated structures on the eye diagram: A. The Eye K G H B. C. D. E. G. H. K.…

A: The concept behind the anatomy of the eye is to understand how the various structures within the eye…

Q: Question 5. Which enzyme is used in the processing of miRNAs that are encoded in the genome but NOT…

A: Introduction - The silencing complex is made up of short interfering RNA (siRNA), miRNA, and the…

Q: Population Growth Temperature & Growth Rate Trout Perch Bass 10 20 30 40 Temperature (°C) 8. A study…

A: Introduction :- Optimal temperature is the temperature range in which an organism functions best and…

Q: 4. You want to perform a sequential double digestion of a 9000 bp plasmid to see if a 450 bp insert…

A: Deoxyribonucleic acid (DNA) is a molecule that contains the genetic instructions that make each…

Q: I need help with the two questions attached below

A: The rate of biomass production  in a particular habitat, at particular unit time  is called…

Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five…

A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5…

Q: Options are on the right. I need to match them to the statements on the left.

A: The bone tissue is of two types- Compact and spongy. Compact bone- The osteon forms the structural…

Q: hcomplete daninance/Codominance Directions Use your knowledge of incamplete dominance and…

A: 1. Red flower plant crossed with Pink flower Genotype of Red flower plant = RR Genotype of pink…

Q: Low leptin levels can lead to diminished overall immune function due to reduced Helper T Cell…

A: Immune system is of two types-  Innate immunity & acquired immunity.  Leptin as a…

Q: TCA cycle

A: TCA cycle is known as Tricarboxylic acid cycle. it is also known as Kreb's cycle. This pathway is…

Q: Identify the catalyst or coenzyme described by the following statements. Write your answer in the…

A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation energy.…

Q: The amino acid sequence of a transmembrane protein has one long stretch of consecutive non-polar,…

A: The proteins that are permanently attached to the cell membrane are known as intrinsic or…

Q: Which scenarios are examples of reproductive barriers between closely related species that can cause…

A: Reproductive barriers are also known as reproductive isolation or mechanism. Reproductive barriers…

Q: Write 5 sentences that describe signaling pathways using the words below. You must use two words per…

A: Signaling pathway- It is a pathway of transferring the signal from the outside environment to the…

Q: The physical constraints to DNA replication presented by the chemical structure of DNA include…

A: Acetylation of chromatin is correct statement .  As acetylation removes the positive charge on the…

Q: 4. End result: The more advantageous trait, brown coloration, which allows the beetle to have more…

A: What would happen if there were no Predators (birds) in the forest? Answer: The numbers of green…

Q: (Last Word) Which of the following statements about energy is incorrect? Multiple Choice Energy…

A: In the dynamic landscape of global energy, accuracy is paramount. The presented multiple-choice…

Q: DB. Bloo ype Exercise determining possible parents A child has a blood type of "B positive". This…

A: Blood Group Type The human blood group type is identified by three different alleles. These alleles…

Q: What are exons? Amino acid sequences that code for a functional protein O Sites where repressor…

A:

Q: Please DO NOT REJECT MY ANSWER. It's just two questions please do not reject my answer. PLEASE…

A: Epigenetic markers - Epigenetics means above genetics. It is the type of inheritance which is not…

Q: This was previously rejected due to not including all parts of the question. I've added all parts in…

A: Since you have posted a question with multiple sub-parts, we will solve first three subparts for…

Q: Write the name of each type of energy next to its description Energy carried in photons - Energy…

A: Energy carried in photons - Photon energy It is the energy carried by a single proton, the magnitude…

Q: 42, The following is correct regarding embryonic development a, the egg is only viable for 3-4 days…

A: 42. The following is correct regarding embryonic development b. the egg is only viable for 12 to 24…

Q: 26. Draw a phylogenetic tree including all of the following groups: charophyte green algae…

A: Evolution is the process of gradual changes occurring in the species over a period of time.…

Q: Compare identical and fraternal twins. In your response, use the word: monozygotic/dizygotic Why are…

A: Twins are two offspring produced by the same pregnancy. Twins can be either monozygotic or…

Q: Why do identical twins become increasingly different over time? In your response, use the words:…

A: Since your second question graph is invisible, I will solve the first question only .  Even…

Q: 9% dextrous solution (9 mg per 100 ml. of solution) is given

A: A. 1a. In order to calculate flow rate    of dextrose we have to use following formula 2.18 L = 2180…