6. Different breeds of Korean cattle produce meat with varying amounts of stearic, linoleic andoleic acid. These differences are heritable and can be used in breeding programs to producebetter beef. Mutations in fatty acid synthase are responsible for at least some of thesedifferences. Which domain(s) would you expect to carry mutations in order to affect the ratiosof stearic, linoleic and oleic acid produced? Justify your choice(s).

Fatty acid synthase (FAS) is a large multifunctional enzyme that is responsible for the synthesis of…

Answered: Different breeds of Korean cattle…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Which of the following would be most likely to be a conservative or mild mutation? Histidine (His) > Valine (Val) Arginine (Arg) > Aspartate (Asp) Valine (Val) > Isoleucine (Ile) Leucine (Leu) > Lysine (Lys) Glutamate (Glu) > Proline (Pro)
Albinism is a condition where individuals can't make melanin pigment. The affected gene encodes for tyrosine aminotransferase, a key enzyme in melanin production. If you analyze the DNA of an albino individual, of the following mutations, which one is the least likely mutation responsible for the albino phenotype? A. A substitution of A to G at 3' splicing site. B. A deletion in the TATA box region. C. An insertion after the start codon. D. An extra stretch of TTAATT in intron 1.
A scientist is researching GS1, an enzyme with a relative molecular mass (Mr) of 78,000 present in a bacterium. The scientist has isolated two mutant strains of the bacterium as described below. Strain A: In this strain the GS1 protein is completely non-functional. Analysis of strain A shows that it produces a shortened GS1 protein with an Mr of only 38,000. Strain B: This produces functional GS1, but the Kcat is somewhat reduced. Analysis shows it produces a lengthened form of GS1, with an Mr of about 86,000. What type(s) of mutation may have occurred in the GS1 gene in strain A?
A woman has an egg with a mutation for the gene that expresses whether the child can produce lactase enzymes. Here is the new nucleotide sequence with the change in bold. 3’ – ACCTCTTACTTCTATATATAGGGAAGACTAATTGTC – 5’ what type of mutation is this? Will this affect the child's abilty to produce lactase enzymes needed to digest lactose?
Considerable effort has been directed toward determining the genes in which sequence variation contributes to the development of type 2 diabetes. Approximately 800 genes have been implicated. Propose an explanation for this observation.
You generate mutants in the metabolic pathway for starlase. You conduct some complementation tests (after testing for dominance of course) and come up with the following results: 1 2 4 6 1 + + + 2 + 3 + 4 + 5 6 a. How many complementation groups are there? [Select] b. You conduct some additional experiments to elucidate the starlase metabolic pathway. Your results are shown below. Use this information alongside information from the complementation table above to place the intermediates in the correct order on the pathway. (HINT: use the complementation groups from the table above to help you consolidate information on the tables below. Reference practice question 3 from today's lecture for help). Addition to minimal medium Mutant None starlase P 1 + + 2 + + 4 + + 5 + 6 Precursor --> [ Select ] [ Select ] [ Select ] --> starlase c. Mutant 4 has a loss-of-function mutation for which enzyme in the starlase synthesis pathway? [ Select ] E1 E2 ЕЗ Е4 Precursor > Intermediate 1→ Intermediate…
Give an example of a reducing sugar and a non-reducing sugar. What is the chemical group responsible for the reduction reaction in a reducing sugar? Certain fats are important components of a healthy diet. But transfats are associated with increased riskof heart disease. Are transfats saturated or unsaturated fatty acids? What is the difference in chemicalstructure between a transfat versus a cisfat? DNA and RNA are information molecules with different roles in gene expression. List three differences between these two types of molecules.
Hurler syndrome is due to a mutation in a gene that encodes aprotein called α-l-iduronidase. This protein functions withinlysosomes as an enzyme that breaks down mucopolysaccharides(a type of polysaccharide that has many acidic groups attached).When this enzyme is defective, excessive amounts of the mucopolysaccharides dermatan sulfate and heparin sulfate accumulatewithin the lysosomes, especially in liver cells and connectivetissue cells. This accumulation leads to symptoms such as anenlarged liver and spleen, bone abnormalities, corneal clouding,heart problems, and severe neurological problems. The pedigreebelow contains three members affected with Hurler syndrome,indicated with black symbols. Based on this pedigree, does thissyndrome appear to follow autosomal recessive, autosomaldominant, X-linked recessive, or X-linked dominant inheritance?Explain your reasoning.
As stated in the text, mammalian cells can become resistant to the lethal action of methotrexate by the selective survival of cells con- taining increases in dihydrofolate reductase gene copy number so that intracellular levels of the enzyme become very high. What other biochemical or genetic changes in cells could cause them to become resistant to methotrexate?
Consider the mechanism of the enzyme RNase:  What would happen to the Km (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a lysine? Explain.  What would happen to the Kcat (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a valine? Explain.
The microenvironment of an amino acid side chain refers to the immediate environment that surrounds the side chain. The microenvironment can affect its chemical properties including the pKas. Consider the carboxyl group of an aspartate side chain (average pka of 3.9 for the free amino acid in water) of a globular protein and how the following environments can affect the pKa of the side chain. Will the following environments increase or decrease the average pKa of the aspartate side chain? [ Select] | Select Environment 1: Buried in a hydrophobic pocket on the surface of a protein. The pKa will stay the same increase decrease • Environment 2: In a hydrophobic pocket adjacent to a glutamate side chain. The pKa will [ Select] stay the same increase to the same degree as that in Environment 1 increase to a value that is greater than that in Environment 1 increase to the same degree as that in Environment 3 • Environment 3: In a hydrophobic pocket adjacent to a lysine side chain. The pka…
Phosphofructokinase (PFK) catalyzes a key step in glycolysis. This enzyme is composed of three distinct subunits, muscle (M), liver (L) and platelet (P), which are expressed in different tissues. Mature human muscle contains exclusively the M isoform, while red blood cells express both M & L subunits. PFK gene mutations lead to M protein deficiency, intolerance to vigorous exercise and may lead to hemolytic anemia (Tarui disease). Which of the following can you conclude from the above information? Select all that apply. The muscle cells will be able to generate ATP through oxidative phosphorylation in the presence of oxygen U There may be a total lack of PFK activity in muscle O The red blood cells will be able to generate ATP through oxidative phosphorylation in the presence of oxygen U Hemolytic anemia may be due to instability of the L subunits in red blood cells

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS