Diagram generally how a mRNA that contains sequences corresponding to four (4) exons would be translated. How many domains would the protein that results from translation contain?

Q: Explain the term polycistronic mRNA.

A: An m RNA that can encode for many proteins is known as polycistronic m RNA.. This m RNA is present…

Q: Which, if any, of the following sequences cannot exist for a mRNA. Explain your answer. UUUUUU…

A: Instructions for construction of proteins is done in 2 steps- transcription and translation.…

Q: If a human gene is found to contain five introns, the mature mRNA encoded by that gene would have…

A: Introduction  The parts of a gene that are translated into proteins are called exons. Introns are…

Q: Give some points about the flow of information during translation?

A: Translation is the process of protein synthesis from mRNA (Messenger ribonucleic acid) with the help…

Q: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

A: If DNA codes for mRNA and mRNA codes for protein, then how can the same DNA sequence generate…

Q: The sequence A is read by RNA polymerase to produce an mRNA that is translated by the ribosome:…

A:

Q: Select the description of an intron. (If possible, please explain why it is that answer)  a.)…

A: Pre-mRNA contains both introns and exons in it's sequence. This pre-mRNA then undergoes modification…

Q: Suppose that section x, y, and z of the following hypothetical DNA strand are the exon (coding…

A: Exons and introns are nucleotide sequences within a gene. Exons are the coding sections of a gene…

Q: The coding DNA strand of a gene has the following DNA sequence:  5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’…

A: Answer: Central Dogma : It is the complete procedure of replication , transcription and translation…

Q: Consider the following segment of a template strand of DNA: Part A -АТА AGC TTC GAC What is the MRNA…

A: Transcription is the process of making an RNA copy of a gene sequence known as mRNA by using DNA as…

Q: A double-stranded DNA molecule with the sequence shown below produced a peptide. a) Label the start…

A: Transcription generates several kinds of RNA from DNA. Transcription would be similar to making…

Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…

A: DNA is a double stranded helical structure present inside the nucleus. It acts as a hereditary…

Q: Label the features of a tRNA by dragging the labels to the correct targets. A Binds an amino acid B.…

A: tRNA is also known as transfer RNA which helps in the transfer of amino acid to the mRNA codon…

Q: A segment of template DNA is known to contain the following base sequence: 3'…

A: The DNA sequence given above is a template for transcription, which is the process by which mRNA…

Q: Transcription and translation are separate processes in gene expression; however, they have…

A: Central dogma is a process where particular segment of DNA or gene ultimate express as a protein or…

Q: An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon,…

A: The central dogma describes the flow of genetic information. It states that genetic information in…

Q: A eukaryotic mRNA has 703 total nucleotides. 50 of these are the 5'UTR and 50 of these are the…

A: The triplet codon (genetic code) is the group of three consecutive nucleotides that code for a…

Q: the two ribosomal subunits did not come together during translation, and the small subunit attempted…

A: Translation is the process where codons in the mRNA are used to generate a polypeptide.