Determine each of the following items using the hnRNA nucleotide sequence (enter the answer using the dash). exon intron exon 3' CAAG - AUGC - CGUAC 5' (a) The sequence of bases on the DNA template strand from which the hnRNA was synthesized: 3' 5' (b) The sequence of bases on the DNA informational strand used to synthesize the hnRNA: 5' 3' (c) The sequence of bases in the mRNA produced from the hnRNA:

DNA Leading strand: 5' AAA ATA | CGC TTT| TTA ATT | AAC CCC GGG 3' A I B IC| D Exons: A, C, D Introns: B 1. What is the structure of hnRNA transcribed from this template? 2. What is the structure of the MRNA obtained by splicing the hnRNA? 3. What will be the polypeptide sequence to be synthesized using this mRNA?

c) Based on your answer to part b above, determine the polypeptide sequence produced by the ribosome from the mRNA which you transcribed

Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B )  Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid.  Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?