Define the term fragmentation.

Q: The genome of bacteria cells, eukaryotic cells, and viruses are all about the same size. True or…

A: Genomes can be described as the haploid set of chromosomes present in an organism.

Q: Describe the steps that occur during bacterial transformation?

A: Bacterial transformation is method of gene transfer by which some bacteria take up foreign genetic…

Q: Tm value, the GC-content of the selected DNA sequence and the absolute nucleotide composition of the…

A: DNA stands for deoxyribonucleic acid and it consists of 4 types of nitrogen bases, adenine, guanine,…

Q: In the early 1940s, Oswald Avery and his team set out to identify the conditions necessary for…

A: Big and complicated macromolecules play an important part in the functioning and regulation of our…

Q: The technique of DNA sequencing involves performing _______________ . A) northern blotting B)…

A: DNA sequence can be determined by performing DNA sequencing method in vitro.

Q: When half of the DNA in the sample is double-stranded, that point is termed the half- reaction time…

A: Cot values give the renaturation index of the DNA strands. Cot 1/2 value defines that 50%…

Q: Complete the following table with the proper terms: Process Molecule made name of monomer Name…

A: DNA replication in molecular biology is a biological process through which one double-stranded…

Q: pMDawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI:…

A: Given: Digestion of a plasmid PMDawn with EcoRI, BamHI, and EcoRI+BamHI are as follows: EcoRI: 20 kb…

Q: tail the process of Sanger sequencing. Include a diagram

A: Sequencing of genetic material involves visualizing the number and arrangement of base pairs. It is…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during…

Q: Indicate where each of the following processes occurs (nucleus, cytoplasm or mitochondria).…

A: In humans, the genetic information present in the cell is in the form of the Deoxyribose Nucleic…

Q: List two advantages of using sequence analysis of ribosomal components in classification?

A: A ribosome is a cellular structure involved in protein synthesis, which is a fundamental process in…

Q: If a uidA amplicon generateed by PCR is 200bp and the DNA fragments resulting from the restriction…

A: INTRODUCTION Polymerase Chain reaction This is the method of amplification of of nucleic acids such…

Q: Translate and transcribe the following DNA molecules DNA:AATACGGGGGCGTAACCACTA mRNA: amino acids:

A: DNA is a molecule that carries genetic information. It contains instructions used in the growth,…

Q: Draw an Illustration of the steps and other methods involved in recombinant DNA ( Please make it…

A: Recombinant DNA is a type of DNA that is made up of sequences from various sources. The steps in the…

Q: Review the description of Fred Griffith's experiments with Streptococcus pneumoniae. Using your…

A: The transfer of genetic material between cells is divided into two major categories: horizontal and…

Q: The following chromatogram is obtained from the sequencing reaction. Using the key below, what…

A: Saccharomyces cerevisiae or Baker's yeast is used as tool in various genetic experiments. This is…

Q: The primary eubacterial mRNA transcript (polycistronic) is usually characterized by the presence of:…

A: Eubacterial mRNA transcript - Eubacterial mRNA transcript is a type of bacterial transcript.…

Q: There are 6 parts to this question: This is a follow up to the prior question regarding the…

A: C. DNA Helicase- The enzyme responsible for separating the two strands of DNA in a helix so that…

Q: Explain how each of the following processes complicates the concept of colinearity. Q. RNA editing

A: Some RNA molecules are altered after transcription to produce bases not encoded in the genome. This…

Q: Use the graph to identify the most likely consensus sequences. Assume this is a prokaryoticcell,…

A: In molecular biology, the consensus sequence is the most frequent sequence of wither amino acid or…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: DNA fragments – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…

Tissue renewal

In multicellular organisms, tissue is a level of structure that consists of a group of physically and functionally identical cells and their intercellular substances. Unicellular organisms do not have tissues. Tissues are absent or poorly differentiated even in the simplest multicellular animals, such as sponges. However, more evolved multicellular animals and plants have specialized tissues that may organize and govern an organism's reaction to its surroundings. The word tissue is derived from the Latin word 'weave.' Plants and animals have various kinds of tissue systems that differ in their work and composition according to the different requirements.