Could anyone describe 3 mechanism pf protein processing (how it is done and what is benefit). How this can lead to human pathology (you dont need to name the diseases)?
Q: Answer for 1 ,2,and 3 asap
A: Answer given in steps 2 onwards. Please find the attachment. Thank you
Q: Remember that although there are many interesting ideas about genetic engineering of plants and…
A: Genetic engineering is a one of the modern technology to modify organisms, plants, crops & even…
Q: agri-biotechnology and GMOs (Genetically Modified Organism)? Why does this remain to be one of the…
A: Biotechnology is the technology that develops different products by utilizing biological substances.…
Q: There are two major paths utilized for protein engineering: The rational design The directed…
A: Protein Engineering --Protein Engineering is the the process by which a protein sequence by using…
Q: A. What do scientists do to adult cells to make them “behave” like embryos? B. Transgenic, cloned…
A: The embryo is formed from the fusion of the male gamete and the female gamete in the process of…
Q: A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAA…
A: Mutation is defined as the sudden and permanent change in the nucleotide sequence of DNA. Missense…
Q: Choose any GMO that currently exists (bacteria, plant, animal, human), even if it was not…
A: The gene of organisms can be altered to modify them for a particular human use. Often this…
Q: Explain the application of protein engineering in medicine? Please answer at your own words, please.
A: Protein engineering is the modification of pre-occurring proteins by changing the amino acid…
Q: A CODING STRAND of DNA has the sequence 5' ATGCCG 3' what would the resultant mRNA transcript…
A: Coding strand is the strand which contain the sequence that are identical to the mRNA transcript…
Q: what is your opinion on Genetic Engineering? Support your opinion with facts and include the issue…
A: Genetic engineering: Genetic engineering is the process of altering an organism's genetic makeup…
Q: Which characteristics describe the genetic code of humans? Select three options. can help in the…
A: Genetic code is the term we use for the manner in which the four nitrogenous DNA bases — A, C , G,…
Q: Are placebos unethical? According to the Declaration of Helsinki, under what conditions are placebos…
A: Placebo is inactive pills or Medicine without active pharmaceutical ingredients which is used to…
Q: Gene alteration due to mutagen may cause adverse effect on our life. However, not all mutations can…
A: Mutations are changes in the sequence of our DNA, either due to errors in DNA copy or due to…
Q: 8-12 years old child's eye retina area is yellow. Which methodology do you follow to develop a…
A: Our eyes appears as orange due to the presence of a layer of pigmented cells inside the retina. This…
Q: Suppose you carry out genomic, transcriptomic, and proteomicstudies on a single tissue. What type of…
A: Omics is the informal branch of biology that includes disciplines like transcriptomics,…
Q: Although it is well known that X-rays cause mutations, they are routinely used to diagnose medical…
A: In the United States, radiation absorbed dose, effective dose, and exposure are sometimes measured…
Q: Why some people resort to phenocopy? Write the pros and cons of phenocopying in not more than 50…
A: Phenocopy is a variation in an organism characteristics who resembles a genetic one but has…
Q: Why do some people resort to phenocopy? Write the pros and cons of phenocopying
A: A phenocopy can be defined as the trait which is present in an individual but the individual does…
Q: In diseases such as Creutzfeldt-Jakob disease (CJD), a normal prion protein becomes infectious and…
A: Creutzfeldt-Jakob Disease: Creutzfeldt-Jakob disease (CJD) is a neurodegenerative disease that…
Q: After translation a protein needs to be folded correctly in order to function properly: C) What…
A: Proteins are long chains of amino acids. There are 4 types of proteins based on their structure:…
Q: Below are some of the arguments about the use of transgenic organisms. From your own perspective,…
A: Note- we are supposed to answer 3 subpart of a question according to our guidelines. Please repost…
Q: The antibiotics puromycin and erythromycin are known inhibitors of protein synthesis. (a) Which…
A: Antibiotics are usually defined as related to their mechanism of medications that are used to treat…
Q: Which of the following best describes the central dogma of molecular biology? O A) MRNA is…
A: Introduction In molecular biology, a central dogma is an illustration showing the flow of genetic…
Q: Give the pros and cons of Genetic Engineering. PROS CONS 1. 2. 3. 4. 5. 2.What is Genetic…
A: There are many pros and cons for genetic engineering, that includes: Sl.No Pros Cons 1 Provides…
Q: How ribosomes causes problems in treacher Collins Syndrome disorder? Please write it in a…
A: Treacher Collins syndrome is a genetic disorder that most often affects the cheek bones, jaw, chin…
Q: 2a. The DNA is mutated on the 4th base pair to the following: DNA:3'TAC GAT GAG GTC 5' АTG CТА СТС…
A: No, this mutation might not change the way in which the protein functions. In this mutation the…
Q: Ten example of Human protein in therapeutic genetic technology that have available in genetic…
A: Genetic Engineering: Genetic engineering is the process of altering an organism's genetic makeup…
Q: Biotechnology is a constantly developing field with many exciting applications. It focuses on the…
A: Gene transfer is the method of inserting genetic material (DNA or a gene of interest) into cells…
Q: CRISPR has the potential to change everything. What potential benefits of this technology are you…
A: CRISPR stands for clustered regularly interspaced short palindromic repeats. It is a technique…
Q: The sequences (N-terminal to C-terminal) of the smaller peptides produced by trypsin digestion were…
A: Enzymes can catalyze several reactions and aid in speeding up a reaction. There are several enzymes…
Q: Which one of the following best represents the central dogma of Bioinformatics? O…
A: The 'central Dogma' is the cycle by which the guidelines in DNA are changed over into a functional…
Q: Which of the followings is not function of Golgi? O Protein taging O Protein sorting and…
A:
Q: A faulty protein is found in the cell. A further investigation proved that the DNA sequence in the…
A: Answer- According to central dogma the protein is formed by translation of the mRNA and it is formed…
Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…
A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…
Q: Which of the following organisms incorporates peptides along with carbohydrates in its cell wall…
A: Cell wall is a protective layer outside the cell which protect cell stresses. It is the outer…
Q: What is the most important factor should be taken inconsideration to choose the organism in upstream…
A: Biotechnology is technology that utilizes biological systems, living organisms or parts of this to…
Q: Why are RNA viruses more likely to mutate than those that have genomes made of DNA? 2.What would…
A: Viruses generally have genetic material, either DNA or RNA inside a coat of proteins and…
Q: Refer to the sequence below to answer the following questions. 5’-…
A: DNA is a double-stranded molecule. Each strand has a polarity, such that the 5'-hydroxyl group of…
Q: What are the pros and cons of genetic engineering. Give at least 3 each
A: A gene is a unit of hereditary present in thousands of numbers on the helical strands of…
Q: I would like to know a list of examples on different human diseases that has a genetic basis and can…
A: Genetic disorders are caused because of mutation in genes.
Q: Let's Explore This module we will be discussing about the DNA and mRNA and its role in performing a…
A:
Q: What data have been complied in the Human Protein Atlas? https://www.proteinatlas.org/about A.The…
A: The Human Protein Atlas is an extensive database used for wide distribution of proteins, which are…
Q: Why is it necessary for RNA to be involved in protein synthesis? Why can’t DNA directly synthesize…
A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. DNA is formed of the…
Q: The sequence of subunits in a DNA molecule is more important to its function than the number of…
A: DNA instructions are translated into functional products using a 'Central Dogma'. The central dogma…
Q: All of the following are true regarding mRNA processing except: O a. It occurs in the cytoplasm of…
A: The central dogma represents the flow of genetic information from DNA to RNA to protein. DNA…
Q: A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg-tyr. A…
A: Point mutations can be defined as mutations in single nucleotides. In point mutation, a nucleotide…
Q: Which of the following statements are correct? explain your answers.A. An individual ribosome can…
A: Introduction :- The site of protein synthesis in the cell is the ribosome, which is an intercellular…
Q: For the p53 gene, create a summary with a proteomics focus. You can include protein domains, protein…
A: p53 gene: It is also known as TP53 or tumor protein . It is a gene that makes a protein that is…
Step by step
Solved in 3 steps
- If mRNA can be blocked, what would the consequences be? Critically thinking about this, what applications could this be useful when treating diseases? You can be as wild as you like here, as long as you are using fact as the foundation of your post!Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly (i.e., which molecule is actually translated?). E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites (in both prokaryotes and eukaryotes) and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly…Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of genetic information is diagrammed below. Think carefully about what type of molecule is represented by each item in the diagram and clearly address each of the following. A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate which is processing, transcription, replication, and translation. C. Identify the general location (on the appropriate molecule) of the promoter sequence and the terminator sequence. D. Identify the specific location of the place where the start codon and stop codon function most directly. E. Where does RNA polymerase bind to begin transcription? F. Where specifically does the ribosome bind to begin translation-i.e., what are the ribosome binding sites and where are they found? G. Label each end of the mature mRNA and the polypeptide to correctly specify polarity. (You should use the labels 3', 5', C-terminus, and N-terminus.)
- The queation on my assignment is select the description of an exon? the answers they give are: 1. sequence of adenine nucleotides added onto the end of pre‑mRNA 2. modified form of a guanine nucleotide added onto the end of pre‑mRNA 3. coding portion of a DNA sequence that is present in mature mRNA 4. noncoding portion of a DNA sequence that is removed from pre‑mRNA then it wants you to explain your reasoning for your answer that you pickedA small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1. Valine 2. Serine 3. Proline 4. Glycine 5. Arginine 6. Leucine 7. Histidine 8. Cysteine 9. Glutamine The amino acids listed above that are coded by the MRNA codons are , and Record your answer in order from left to right codons.please help molecular biology technique Gene cloning & identification that have been used to study the protein Epidermal growth factor receptor I need to following using 1 journal article. please provide the link in the end i will appreciate it. and provide the answer in 1-3 paragraph per each part part 1 Detail the technique used to study this protein. part 2 What were the results reported for the protein using this technique (clear understanding of the set of results.
- The RNA that transports the base sequence information to the ribosomes is called RNA or RNA. Enter your answers separated by a comma.Here is your sequence of DNA to use to do transcription, and then translation: TACAGTCCGGAATTCGCACTTGGGTATATCWhich of the followings is not function of Golgi? Protein taging O Protein sorting and modification Protein glycosylation O Lipid metabolism
- SAY IT WITH DNA: PROTEIN SYNTHESIS WORKSHEET: Practice Pays Student Handout Having studied the process by which DNA directs the synthesis of proteins, you should be ready to decode some DNA "secret" messages. To do this, you must follow the procedure of protein synthesis as this is taking place right now in your cells; no short cuts! Practice these steps by following and finishing the partially solved message below. STEP 1: "Build" the mRNA molecule, matching the RNA nucleotides to the DNA nucleotides properly, letter by letter. (For purposes of simplicity, it will be assumed that this mRNA is bacterial; there are no introns to cut out!) STEP 2: Figure out the tRNA triplets (codons) that would fit the mRNA triplets (letter by letter). STEP 3: Look up each tRNA codon in the tRNA Dictionary (below), and find the corresponding symbol and amino acid abbreviation for that codon. Record that one-letter symbol (and its amino acid) below each codon. "Spc" = "space". If you have done this…Choose any/all that apply to protein synthesis. Ribosomes aid in the formation of peptide bonds solely due to placing amino acids in proximity of one another, and in the proper orientation. The degeneracy of the genetic code is rather helpful, minimizing the harmful effects of many mutations. The 64 tRNA molecules are incredibly complex, with many features in common with one another yet with enough variability to perform the unique job that each must do. The ribosome reads mRNA in the 3'-5' direction, allowing the anticodon loops of tRNA to interact in the proper orientation with the mRNA. Of all the metabolic processes we studied over this course, protein synthesis produces the most energy.Direction: Study the given amino acid sequence and DNA sequence of the Amino Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-LEU-LEU-SER What's More Activity 3.1 Check and Relate listed organisms. Cat DNA Sequence: TTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT Am no Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-EU-SER-ARG-LEU-LEU.AD DNA Sequence: CTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Shark Amino Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-VAL-VAL-SER DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGT Colphin Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-LE-LEU-LEU-SER-ARG-LEU-LEU-ARG DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Lizard Amino Add Sequence: ISO-4SO ASP-GLN-PHE-ILE-LEU-HIS-SER-ARG-LEU-LEU-ARG DNA Sequence: ATTATCGACCAGTTTATCCTACATTCCCGTCTACTTCGT Sponge Activity Questions: 1. Which organisms are closely related to each other? How are they related? 2. What does this tell us about the organisms and their ancestors? 3. How amino acid sequences and DNA…