CONVERT THE FOLLOWING: DNA - ACA AGA CGG TAC TGA mRNA - _______________ tRNA - _______________ Amino Acids:
Q: TRNA has peptidal transferase activity. True False Genetic information stored in mRNA is translated…
A: A ribosome is a biological unit made up of Protein molecules and RNA that functions as the cell's…
Q: A DNA sequence can be represented as a string of the letters ACTG (short for , cytosine, guanine,…
A: The sequence of DNA defines the order of the four chemical building blocks called bases that make up…
Q: 3' AAAACTGTGCAT5'
A: In order to take the needed information from DNA, cells first makes a copy of the DNA nucleotide…
Q: A mutation converts an AGA codon to a TGA codon (in DNA) this mutation is
A: The mutation is sudden change occurs in the nucleotide sequence of DNA. It is due to exposure of…
Q: Define the following terms:a. mRNA scanningb. transcript localizationc. glycosylationd. targetinge.…
A: The proteins are synthesized from the mRNA, which is modified post-translationally in ER. After…
Q: (A) involves the formation of a peptide bond between the amino acid and tRNA
A:
Q: Below is a sequence of mRNA. Use it to answer the questions below. 5' -…
A: The central dogma in both prokaryotic and eukaryotic cell consists of a series of steps including…
Q: The structure below is a fragment of what molecule? NH₂ NH, OP.OCH, OPOCH, oroc, QPOCH, O DNA ORNA O…
A: There are two kinds of nucleic acids DNA and RNA. DNA is double started molecules and RNA is a…
Q: Each ribosomal subunit is composed of a. multiple proteins. c. tRNA. b. rRNA. d. both a and b.
A: The rRNA or ribosomal RNA is involved in translation. The ribosomal protein along with the rRNA make…
Q: protein that charges its conformation ( and often its activity) when it binds a regulatory molecule…
A: Answer - Ligase - The RNA primer is responsible for initiation of DNA synthesis are removed by…
Q: If a strand of mRNA is UGC CAU GCC, what is the sequence of amino acids that will be produced? (use…
A: Proteins or polypeptides are the end products of the gene expression process. They are polymers made…
Q: Contains deoxyribose instead of ribose. O messenger RNA O DNA O transfer RNA
A: Nucleic acids contain the genetic information needed for functioning of cell. These are of two types…
Q: RNA molecules differ from DNA molecules in that they * a. are single stranded rather double…
A: Codon is a sequence of three DNA or RNA nucleotides. Codons encode the amino acids which eventually…
Q: DNA: | CAT AGG GAG | CAA GGG TGA CTT TTT | AAT AAT GAC GGG|| MRNA: amino acids:
A: As per our company guideline we are supposed to answer only first queation . So kindly repost other…
Q: which of the following is mismatched a- small RNA catalyic with or without proteins b- rRNA 80% of…
A: RNA is coded from DNA with the help of RNA polymerase enzyme; the process of RNA synthesis is called…
Q: This CGT ACT GCA TCA GGC sequence of nucleotides is a referred to as sequence
A: Every biomolecules is a polymer made from a number of monomers. DNAs are the polymers of…
Q: The process of transcription is represented by letter
A: DNA is transcribed into mRNA and mRNA is translated into protein.
Q: Match the following with the correct process. converts DNA into mRNA occurs in the ribosome 1.…
A: All new proteins in the cell are formed by conversion of DNA to amino acids. conversion of DNA to…
Q: Define the following keywords: DNA MRNA protein. tRNA
A: The biological level of an organization is a hierarchy that arranges the living things from simple…
Q: TRANSLATE this RNA sequence: AUGCAAUGA Met-Gln-Stop Met-His-Stop O Thr-Glu-Stop O Thr-Pro-Stop
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: TRNA has peptidal transferase activity. 1 point True False Genetic information stored in mRNA 1…
A: Q. tRNA has peptidal transferase activity. True False Q.Genetic information stored in mRNA is…
Q: The molecule that carries the genetic information of DNA fromthe nucleus to the cytoplasm to be used…
A: Ribonucleic corrosive (RNA) is an extra-atomic hereditary material that lies in the cytoplasm.…
Q: 3. DNA → TAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC MRNA → protein →
A: According to Bartleby guidelines, when multiple questions are posted we are allowed to answer the…
Q: TRNA * Carries amino acids in the cytoplasm to ribosomes for protein assembly Amino Acid attachment…
A: The correct answer is (b) amino acid attachment site across from anticodon site on tRNA Transfer…
Q: Which RNA conformation favors translation—the form with the Shine-Dalgarno antisequestor or the form…
A: Step 1 The Shine-Dalgarno sequence is a ribosome binding site in bacteria and archaea messenger RNA…
Q: 2 1] Amino acids are joined fogether into a protein chain by wfrnich of the following a transfer RNA…
A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…
Q: kle cell hemoglobin DNA ÇACGTAGA CTGAGG ACA ckle cell hemoglobin MRNA ckle cell hemoglobin AA…
A: Sickle cell anaemia is a inherent condition in which red blood cells are abnormally fickle shaped…
Q: The enzyme Aminoacyl tRNA synthetase
A:
Q: If a DNA coding strand sequence reads 5' ATG GGT GGT ATT 3' the corresponding transcribed MRNA will…
A: mRNA is produced as a result of transcription from DNA. mRNA is produced by enzyme RNA polymerase…
Q: How could RNAi be used medically?
A: The basic structural and functional units of life are cells. Trillions and billions of cells make up…
Q: HN. `NH NH H2N° A. В. Consider the 3 structures shown. Which of these is (normally) NOT present in…
A: Nucleic acids are the major class of biomolecules that are important for all forms of the organism.…
Q: ________ are encoded by a nucleotide triplet codon.
A: Answer - Option A - Amino acids
Q: Sequence: AAA UGG CAA Translate the sequence into the correct amino acids. Question 2 options:…
A:
Q: Sequence the following steps in protein synthesis from first to last. Write only the numbers (1-6)…
A: Protein synthesis refers to the process of formation of protein molecules by the cells of an…
Q: 3. 3' CTT TCT TGT AGT TẠC CGG GTA GAA TAG TTG CTG ACT 5'
A: DNA is the genetic material of most living organisms. The DNA is inherited from the parents and it…
Q: Name an enzyme that acts on each molecule.(a) Lactose (b) Protein (c) RNA
A: Enzymes are the proteins that act as a catalyst to carry out the chemical reaction. The enzyme acts…
Q: Write the standard base sequence of the messenger RNA that would cause a ribosome to make the…
A: The amino acids in the protein are placed in the order from N-terminus to C- terminus. The mRNA are…
Q: Draw the protein: SRDR
A: Amino acids are organic compounds that are made up of nitrogen, carbon, hydrogen, and oxygen, along…
Q: Sickle cell anemia occurs due to a point mutation in a gené för changes the amino acid at position 6…
A: Red blood cells are small, round, and convex cells that transport oxygen throughout the body.…
Q: Which type of biological molocule is being made during this process? Incoming tRNA Bound NA to Amino…
A: The figure is showing the process of translation. Translation is the process of formation of a…
Q: Define the following terms:a. homologous polypeptideb. molecular diseasec. protein foldd. mosaic…
A: Ans. a. Homologous Polypeptides have a common ancestor, whatever their sequences, structures, or…
Q: GTC TCC ATC CGG ACT DNA MRNA TRNA AA | !!
A: DNA is a genetic material that code for protein . It carries genetic information and transfer them…
Q: Define the following terms: a. rRNA b. tRNA c. mRNA d. siRNA e. miRNA
A: The nucleic acid is a significant macromolecule that is found in all living constituents. The…
Q: Transcribe the following DNA sequence into RNA, and then into amino acids…
A: Transcription is the process by which the information stored is transcribed into mRNA. And…
Q: A _____________________ is a multienzyme complex thatsynthesizes RNA primers during E. coli DNA…
A: A multienzyme complex refers to the stable assembly of two or more enzymes that carries out a single…
Q: Match each process with its product._____ transcription a. DNA_____ replication b.…
A: Central dogma explains the flow of genetic information. It states that information flows from DNA to…
Q: The number of amino acids produced by translating the mRNA (3'AUGCUUAGUCGCGUA5') is : a. 4 b. 5…
A: The three letter codes for amino acids are the universally accepted amino acid codes that are…
CONVERT THE FOLLOWING:
DNA - ACA AGA CGG TAC TGA
mRNA - _______________
tRNA - _______________
Amino Acids:
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- DNAT A C C G C T C C G C C G T C G A C A A T A C C A C T mRNA ______ ______ ______ ______ ______ ______ ______ ______ ______ AA ______ ______ ______ ______ ______ ______ ______ ______ ______Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTC. Then list in order the amino acids coded by this sequence: mRNA ________________________________________________________________ Amino acids _____________________________________________________________Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTCThen list in order the amino acids coded by this sequence.mRNA ________________________________________________________________amino acids ________________________________________________________________ 2. Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of themRNA strand in question 1 began, by mistake, at the second nucleotide instead of the first. The first codonwould be AUA. Write the sequence of amino acids that would be formed.__________________________________________________________________________
- ___________________ stabilize the structure of DNA and proteins.What is the complementary DNA sequence to the following DNA sequence? ATGCCATCG ____________________________ Write the mRNA codon sequence for the following DNA sequence. CTGCACTGA ____________________________ Write the anticodon tRNA sequence for the following mRNA sequence. UACGACUAG ____________________________ Name the amino acids that use the following mRNA codons. CAU ______________________________ AUG ______________________________ AAG ______________________________ CCC ______________________________ Name the amino acids that use the following DNA codons TAT ______________________________ CGA ______________________________ List the amino acid sequence for the following mRNA code. Be sure that you start with the first start codon you get to and then proceed to list the amino acids until you get to a stop codon. CGUAUGACUGGAAUACUUUAGCCAGCU __________________________________________________________________Define adenosine diphosphate (ADP)
- Sequence: AAA UGG CAA Translate the sequence into the correct amino acids. Question 2 options: Lys Trp Stop Lys Trp Gln Stop Lys StopThe distal histidine stabilises the iron in heme group of a deoxyhaemoglobin. T/FWrite the CODON that corresponds with each amino acid. There may be more than one. The full names are written, but the codon chart only shows the first three letters. glycine ______________________ phenylalanine ______________________ arginine ______________________