Complete the following sentence: RNA splicing removes the non-coding sequences (_----_) from pre-MRNA, and joins the remaining coding sequences (__) to produce an mRNA strand with a continuous coding sequence. introns ; exons 3' end; 5' end exons; introns 5' end; 3' end
Q: What happens to the pre-mRNA before it migrates to the cytoplasm? Explain
A: Answer: TRANSCRIPTION : It is the process in central dogma where DNA is transcribed in to RNA by…
Q: Which enzyme removes a phosphate from the 5' end of the MRNA, leaving two phosphates?
A: mRNA is a messenger RNA, it is a single stranded RNA which carries the genetic sequence of the DNA…
Q: Which of the following segments of RNA are retained after conversion of a pre-mRNA to a mature mRNA?…
A: RNA: it is of different types such as rRNA, tRNA, mRNA etc.
Q: If the DNA gene reads AAT GGT CCA CCG CTG, what will the MRNA read? O A. TTA CCA GGT GGC GAC O B.…
A: DNA is a macromolecule and is composed of nucleotides having sugar , phosphate and nitrogenous bases…
Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…
A: Hi, Thanks For Your Question. Answer : Let's Learn Some Basic Concepts First: Transcription : It Is…
Q: mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping.…
A: A codon is a triplet of the mRNA sequence, which identifies an amino acid. The genetic code tells…
Q: If a eukaryotic MRNA lacked a poly-A tail, where would the MRNA be located? Select an answer and…
A: Transcription is a process through which the template strand of DNA gets transcribed into mRNA. In…
Q: Use the following segment of DNA to determine the mRNA and amino acid sequence that would form.…
A: DNA and RNA are two different forms of nucleic acids, which are biological polymers of nucleotides.…
Q: Explain why the statement is correct. A section of the mRNA has a nucleotide sequence of…
A: mRNA A single stranded RNA which is copied from DNA and contains gene or information about specific…
Q: describe the process of reading a gene and turning it into a protein in a eukaryote.Your first…
A: Transcription: The process of conversion of segment of the DNA to RNA is called as Transcription.…
Q: Which sequences within the pre-mRNA determine where splicing occurs?
A: RNA splicing is a process that produces a mature mRNA from a pre-mature mRNA. The process is started…
Q: Number the following steps of protein synthesis in order in which they occur, starting with 1 and…
A: Translation - it the process in which proteins are formed from ribosomes particularly,from mRNA…
Q: The sequence below is an mRNA strand that is in the cytoplasm ready to translated by a ribosome. If…
A: Translation is the process of formation of a protein chain from a RNA chain. Translation requires an…
Q: RNA Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 Intron 3 Exon 4
A: Eukaryotic primary transcripts are split. That is, they are composed of coding sequences for…
Q: Which components will end up in the final, fully processed mRNA in a eukaryotic cell? Choose all…
A: The m RNA that is formed by the process of transcription from DNA is subjected to pre-processing in…
Q: You may wish to consult the genetic code above to answer the following question. A mutation has…
A: Missense mutation is the mutation in which single amino acid change occurs. The other amino acid in…
Q: The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’…
A:
Q: Without using your textbook, determine what protein sequence would be translated from the mRNA…
A: DNA is the store house of genetic information. This information is in the form of nucleotide…
Q: Number the following steps of protein synthesis in the order in which they occur, starting with 1…
A: Central dogma involves transcribing the information from DNA to RNA and from RNA to protein…
Q: How long is the polypeptide produced from the following mRNA transcript?…
A: We can find this answer using a codon chart- 5-UCA UGC UUG GAC UCA AGU CUA CGU GAA U-3' As each mRNA…
Q: Which of the following mRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…
A: Transcription is the process that synthesizes mRNA from DNA. The mRNA strand synthesized through…
Q: Analyze the following amino acid sequence and write down a potential mRNA sequence from which this…
A: The mRNA is "read" by the genetic code during translation that constitutes the second major stage in…
Q: Complete the phrases with the correct word or words. The task is to match the lettered items with…
A: Genes are sets of nucleotides that codes for a particular protein. The genes have to be expressed…
Q: Which sequences are spliced out of the mRNA strand before leaving the nucleus? In other words,…
A: Answer: TRANSCRIPTION : It is the process in central dogma where a DNA strand is transcribed in to…
Q: Given the following mRNA sequence, write the peptide sequence that will result from protein…
A: mRNA stands for messenger RNA( Ribonucleic acid). Protein translation is a process of making…
Q: If my final mRNA product sequence is this: CAAGAUGUACUUUGCGACAAGAGAGGAUCCCAUCUGUGCGACUUGAACG What…
A: The central dogma of life states that there is a unidirectional flow of information from master copy…
Q: DNA: TACGGGCCTATACGCTACTAC T CATGGATC Corresponding MRNA sequence: Corresponding amino acid sequence…
A: DNA consists of two strands which wind around each other, backbone of the DNA is formed by the…
Q: You have an mRNA transcript that is 201 nucleotides long, including the Start and Stop codons. How…
A: In most living organisms, DNA is the genetic material. DNA contains all the genetic instructions…
Q: If a eukaryotic MRNA lacked a poly-A tail, where would the MRNA be located? Cytoplasm Endoplasmic…
A: The stability of mRNAs varies considerably in the case of eukaryotic organisms. Some mRNAs have very…
Q: Choose the option that goes with the blank. The parentheses after the blank are the choices.…
A: In the process of synthesis of proteins from DNA, the information in DNA is used for the synthesis…
Q: The following gene sequence of nucleotides is found on the template (non-coding) strand of a…
A: The sequence would be opposite to template strand and similar to coding strand(except the thiamine…
Q: The following sequence is the coding strand of a piece of DNA. Type out the corresponding template…
A: The protein sequence can be decoded by a coding or template DNA given. The mRNA strand is the same…
Q: What polypeptide is coded for by this mRNA sequence? 5'-GCU-GAA-GUC-GAG-GUG-UGG-3'
A: Codons are trinucleotide sequence (DNA, RNA) that codes for specific amino acid and chain of amino…
Q: Complete the following table: Type of RNA Functions Transfer RNA (tRNA) In a ribosome,…
A: Macromolecules are very large molecules commonly composed of the polymerization of smaller subunits…
Q: The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What…
A: The process of making a copy of genetic information stored in a DNA strand to a complementary strand…
Q: Write the amino acid sequence based on the following portion of MRNA. Write the name of the amino…
A: The codons which are present on mRNA are will code for specific amino acids based on genetic code…
Q: How many amino acid are in each of the two polypeptides produced? And how many nucleotides long…
A: The amino acids are produced by the DNA (deoxyribonucleic acid) through processes called…
Q: The following segment of DNA codes for a protein. The uppercase letters represent exons. The…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: A segment of mRNA produced by the normal order of DNA nucleotides and the corresponding amino acid…
A: Introduction Genetic code or codon is a three nucleotide sequence present on mRNA. It gives the…
Q: Below is an mRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz…
A: This mRNA sequence have so many genetic code. There are some numerical value on genetic code but all…
Q: Which three codons would code for a different amino acid sequence from that coded for by the mRNA…
A: Given: mRNA base sequence: AGU-UCA-CCA Have to determine which three codons will code for a…
Q: What happens when one base pair of DNA is lost from the coding region of a gene because of mutation?…
A: This type of mutation is known as Deletion mutation in which a single or entire sequence of…
Q: In the space below, list the events that would occur during the processing of a primary RNA…
A: The primary transcripts selected to be mRNAs are adapted in preparation for translation. Precursor…
Q: What protein sequence would a cell make from the following mRNA? 5'- CCAUGCACCAAUAGAUAACCG-3' O PCTN…
A: During the translation, the sequence of nucleotides in the mRNA is translated into a sequence of…
Q: What is the complementary DNA sequence to the following DNA sequence? ATGCCATCG…
A: DNA is genetic material which is involved in transfer of information into the protein. It involves…
Q: Which components will end up in the final, fully processed MRNA in a eukaryotic cell? Choose all…
A: Post-transcriptional modifications are chemical modifications of the primary RNA transcript to…
Q: A mRNA has the following sequence and direction: 5’-AUGUCAACCUAA-3’ What would be the anticodon…
A: Messenger RNA (mRNA) carries the genetic information copied from DNA in the form of a series of…
Q: Name the process in which unwanted mRNA regions are removed & wanted regions are joined.
A: Transcription is a process in which the DNA template is synthesized into mRNA. At the end of…
Q: If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the…
A: DNA strand – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…
Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…
A: Amino acids are the organic compounds that contain the amino group (–NH2) and carboxyl group(–COOH)…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino AcidA segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'
- Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.015347/quizzes/5825797/take 21. The processing events that must occur on the MRNA after it is transcribed, but before it is released into the nucleus include (select all that apply) Primary RNA transcript Exon 1 Intron Exon 2 Intron Exon 3 RNA processing Spliced RNA Exon 1 Exon 2 Exon 3 AAAAAAA 5' cap Poly-A tail 3' untranslated region 5' untranslated region O folding into its functional shape O splicing out exons O adding a poly-A tail O removal of non-coding sections O capping the 5' end hpA segment of mRNA produced by the normal order of DNA nucleotides and the corresponding amino acid chain are given below: mRNA segment: GCC UAC AAU GCG Amino acid chain: Ala-Tyr-Asn-Ala Knowing that insertion mutations shift the triplets by one base, if an insertion mutation adds a U to the beginning of that mRNA segment, what will be the new triplet/codon grouping and the new amino acid chain? Group of answer choices a. U GCC UAC AAU GCG; Ala-Tyr-Asn-Ala b. UCC UAC AAU GCG; Ser-Leu-Gln-Cys c. UGC CUA CAA UGC G; Cys-Leu-Gln-Cys d. UGC CUA CAA UGC G; Ala-Tyr-Asn-Ala e. UGCC UAC AAU GCG; Cys-Tyr-Asn-Ala
- Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acidhe sequence is read from left to right. The table below shows which mRNA codons code for each type of amino acid. UUA - Leu | UCA - Ser UAA - Stop | UGA-Stop UUU - Phe | UCU - Ser UAU- Tyr UGU- Cys CỦA - Leu CCA - Pro CAA - Gln | CGA - ArgA UUG - Leu UCG - Ser| UAG-Stop UGG- TrpG A DNA sequence before and after replication IS SHO Second mRNA base G DNA sequence before replication: UUC - Phe UCC -Ser UAC U TACCTAGCT Туг UGC Cys DNA sequence after replication: A TACCTCGCT Leu CCU - Pro CAU - His CGU. CUU Arg U - Pro CAC - His CGC- ArgC CUC - Leu ССС Pro CAG - Gln | CGG - Arg G CUG - Leu CCG Thr AAU - Asn AGU - Ser Ile ACC - Thr AAC- Asn AGC Ile ACU AUU AUC Ser Lys AGA Arg Thr AAG - Lys AGG - AUA Ile ACA - Thr AAA- A mutation occurred in the DNA sequence during replication. Which of the following, A-D, Arg Asp GGU-Gly AUG - Met ACG GUU - Val GCU - Ala GAU - GỤC - Val GCC - Ala GAC - Asp GGC - Gly Val GCA -Ala GAA - Glu GGA - Gly Val GCG - Ala GAG-Glu GGG-Glv describes the result of the…The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'
- Consider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping. 1. How many codons are represented in this oligonucleotide? 2. If the second G were changed to a C, what would be the resulting amino acidc) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. 2 Second letter с A UUUPhe UAU Tyr UAC. UGU UGCJ UCU) UCC UCA UUG Leu UCG Cys UUC UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CUU CÚC CCU ССС CAU CGU His САC Pro CC CỦA Leu ССА CAA Arg CGA CUG J CCG) CAG Gin CGG AUU ACU AAU Asn AGU Ser AUC le АСC АCА AAC AAA AGC. Thr JArg AUA AGA AUG Met ACG AAG Lys AGG. GAU Asp GUU) GCU GCC GCA GCG GGU" GGC GGA GGG GUC Val GUA GAC Ala Gly GAA Glu GAGJ GUG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? Third letter DUAG DUAG DUAG A. First…The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What would be the base sequence of the mRNA transcribed from this gene? The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. From your answer to the last question, answer this Using the genetic code, give the amino acid sequence of the polypeptide translated from this mRNA. Use the three-letter abbrebviation of the amino acid and start with the start codon and stop in the stop codon.