Complete the following sentence: RNA splicing removes the non-coding sequences (_----_) from pre-MRNA, and joins the remaining coding sequences (__) to produce an mRNA strand with a continuous coding sequence. introns ; exons 3' end; 5' end exons; introns 5' end; 3' end

Q: Which of the following is not a term used to describe an unspliced mRNA? intronic mRNA O primary…

A: In eukaryotic genes, non coding DNA is also present. In most of the eukaryotic genes, coding…

Q: What type of mutation occurred to produce the abnormal sequence (nonsense or missense)? Explain your…

A: A mutation is a change in a DNA sequence.

Q: Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before…

A: The transcription is the process by which RNA is produced from DNA. In case of eukaryotic mRNA, it…

Q: In this MRNA sequence, what reading frame is the START CODON (AUG) in? ACGGAUGCACGUACGU Select one:…

A: Reading frames are the division of DNA or RNA sequences in a set of non-overlapping sets of…

Q: Which, if any, of the following sequences cannot exist for a mRNA. Explain your answer. UUUUUU…

A: Instructions for construction of proteins is done in 2 steps- transcription and translation.…

Q: ture MRNA. What are these modifications and what are their significance? Use = following terms to…

A: When introns are eliminated and the mRNA is regarded suitable for translation, eukaryotic pre-mRNA…

Q: The following is the only intron sequence of a gene that will be excised during the maturation of…

A: RNA splicing is the process of removal of non coding sequences called as introns and joining of…

Q: What would happen to an mRNA produced from a gene that contained a mutation in the 3'UTR region that…

A: Transcription and translation both form a part of the central dogma of molecular biology.…

Q: scientist isolates two specific mRNAs.  One codes for the enzyme fowlase, an enzyme that is involved…

A: Cell is the structural and functional unit of the organism.

Q: describe the process of reading a gene and turning it into a protein in a eukaryote.Your first…

A: Transcription: The process of conversion of segment of the DNA to RNA is called as Transcription.…

Q: Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and…

A: The Central Dogma theory states that DNA makes RNA and RNA makes protein. DNA undergoes Replication…

Q: Which sequences within the pre-mRNA determine where splicing occurs?

A: RNA splicing is a process that produces a mature mRNA from a pre-mature mRNA. The process is started…

Q: Draw a line representing mRNA that has already been processes (introns removed, cap and tail added).…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Indicate which of the following items are associated with transcription or translation.  This could…

A:

Q: 5’-TAATTCTATGATATTAATATC -3’     mRNA sequence:     protein sequence:

A: The process of transcription of DNA to RNA and the RNA to protien  is based on complimantry DNA…

Q: DNA TAC-TAA-AGG-GAA-GAC-GAG-ATC mRNA AA

A: DNA synthesis or DNA Replication-It is the process by which a cell duplicates its genome(DNA)…

Q: Use this diagram of a eukaryotic gene to answer the following questions. Pay close attention to the…

A: Introduction Gene expression is the process through which a gene's information is used to create a…

Q: The sequence: ATTGCCGACGACTTG is complementary to a sequence that is used as a template in…

A: (-) Sense

Q: Cystic Fibrosis is a genetically heritable disease caused by the loss of the chloride channel, CFTR.…

A: Cystic fibrosis is a genetic disease that is characterized by the production of excessively thick…

Q: The following is the only intron sequence of a gene that will be excised during the maturation of…

A: In science, a gene is an essential unit of heredity and a succession of nucleotides in DNA or RNA…

Q: Pick the most complete list of mRNA sequences that translate into Ser.   Question 3 options:…

A: According to the question, we have to find out the option which is the most complete list of mRNA…

Q: Introns are intervening sequences; what are exons?

A: A gene is an essential unit of heredity and a sequence of nucleotides in DNA or RNA that encodes the…

Q: For the following characteristics, state whether they are true for the 5' CAP, the Poly-A tail, BOTH…

A: Central dogma is the mechanism by which information of DNA is converted into a product (protein ) by…

Q: Derive the amino acid sequence that is coded by this mRNA sequence. Use three-letter amino acid…

A: Proteins are made up of amino acids and are necessary for the efficient operation of all living…

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: Protein synthesis or translation process involve at least three steps- In the first step there is a…

Q: Choose the option that goes with the blank. The parentheses after the blank are the choices.…

A: In the process of synthesis of proteins from DNA, the information in DNA is used for the synthesis…

Q: Shown below is the 5' end of an mRNA molecule. What are the first three (N-terminal) amino acids of…

A: Through transcription the DNA molecule is converted into mRNA.

Q: Which of the following processing events occur during or after the synthesls of MRNA molecules in…

A: Transcription  It is the process of makin copy of RNA from DNA. This RNA is known as messenger RNA

Q: After transcription has been completed in eukaryotes, the mRNA molecule first goes through some…

A: Nucleus is main controller of the cell which carries genetic instructions . It contain thread like…

Q: diagram shows a pre essing. present that splicing bind here. What components of this transcript will…

A: Introduction Messenger RNA (mRNA) is a cellular component that transports instructions from DNA in…

Q: After the intron (which is in a lariat configuration) is released during pre-mRNA splicing, a brief…

A: In eukaryotes, the process of transcription and translation takes place in separate compartments.…

Q: Write the amino acid sequence based on the following portion of MRNA. Write the name of the amino…

A: The codons which are present on mRNA are will code for specific amino acids based on genetic code…

Q: Please draw the mature mRNA (before it is ready to be exported from nucleus):

A: In addition to their role in genetic information storage and transmission, nucleic acids are also…

Q: Using the mRNA sequence you made, translate this into a protein sequence. Begin translation at the…

A: The genetic code, which connects the DNA sequence to the amino acid sequence in proteins, is read…

Q: Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and…

A: A frameshift mutation in a gene is when nucleotide bases are added or removed in increments that are…

Q: The following is the only intron sequence of a gene that will be excised during the maturation of…

A: Prokaryotes have simpler cellular organization and gene structure when compared to eukaryotes.…

Q: Below is an mRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz…

A: This mRNA sequence have so many genetic code. There are some numerical value on genetic code but all…

Q: Construct a polypeptide chain by translating the given red strand of the mRNA segment.…

A: Translation It is defined as the process of protein synthesis in which the sequence of mRNA is…

Q: transcript the pre-mrna code, ACCUACGCGCCACACGUUCUCUACUAUCCCC, into mature mrna

A: Nucleic acids are "proteins essential to the structure and operation of all living cells. Nucleic…

Q: Pretend you are a ribosome that is going to translate the following mature mRNA sequence into a…

A: Ribosome: Ribosomes are cellular structures found in all living cells that are responsible for…