℗ cate which diagram shows the following: one daughter nucleus after telophase of mitosis? one daughter nucleus after telophase of meiosis I? C one daughter nucleus after telophase of meiosis II? A one nucleus during prophase of mitosis? Hulda D (11) E 2 4 2 2 n= B _n= I _n= 2 _n= 2 2x 2x _1_x 4x

Q: PECIES 4 no tail SPECIES 2 SPECIES 3 human ears small nose SPECIES 5 no tail human ears SPECIES 1…

A: A phylogenetic tree may be built using the morphological, biochemical, behavioural, or molecular…

Q: The mammalian heart can beat without input from the brain. True Or false?

A: Heart can be myogenic or neurogenic. In myogenic heart, beating rhythm occurs through specialized…

Q: Which of the following processes determines the arrangement of organs and tissues in their…

A:

Q: Make an discussion and conclusion about Parasitic Crustaceans of Farmed Fish.

A: Introduction=Parasitic crustaceans are commonly known to cause serious lesions on farmed fish,…

Q: protein

A:

Q: 3. Complete the table by providing the important details about the 11 human organ system. What does…

A: Organs are composed of many tissues that together perform specific body functions. The interaction…

Q: Which of the following would count as evidence that two populations are different species, according…

A: Species is the unit of ecology. Many individuals of a same species that interact with each other…

Q: Use the following information to answer the next question. The Life Cycle of a Fern 1 and 3 2 and 4…

A: *A fern is a vascular plants which reproduce through spores and it doesnt have seeds and flowers.…

Q: For each of the following sequences, fill in either the DNA, the mRNA sequence, or the amino acid…

A: The given mRNA sequence: AUG ACU AGC UGG GGG UAU UAC UUU UAG  The corresponding DNA sequence will be…

Q: A mature oak and hickory forest ecosystem experienced an intense forest fire that burned the…

A: A wildfire, also known as a forest fire, bushfire, wildland fire, wildland fire, or rural fire, is…

Q: Using the letter "R" what is the genotype of Nathan Summers? Use the uppercase letter to represent…

A: Introduction  A pedigree gives a clear depiction of the makeup and medical history of a family.…

Q: Viruses are made of: a.) nucleic acid and DNA b.) Nucleic acids and proteins c.) proteins and…

A: Introduction  Of all the microorganisms, viruses are the tiniest. According to some estimates, 500…

Q: suppose that in generation 0, the frequency of allele A1 in a population of armadillos is 0.4. In…

A: Given that, the frequency of A1 allele in a population of armadillos is 0.4 in generation 0. In…

Q: I sequence the DNA of 3 people and see variation in my gene of interest as follows:   Person 1:…

A: DNA sequence variations among members of a population are referred to as genetic variation. Germ…

Q: When you look at an adult flowering plant (an angiosperm), what you see as a plant is the: The…

A: Introduction  The class of plants known as flowering plants, or angiosperms, are those that produce…

Q: What two important characteristics allow us to identify a cell in interphase?

A: An active living cell undergoes two major phases - the mitotic phase where the cell divides into two…

Q: Discuss in detail the inherited disorder in which affected individuals secrete abnormal  body…

A: Cystic fibrosis is an autosomal recessive disorder, meaning that is not inherited solely from the…

Q: Does Totoaba offer any ecosystem benefits? I know their demise is causing the Vaquita to go extinct…

A: Totoaba: Totoaba is a large marine fish found in the Gulf of California, is well known for its high…

Q: What is a nucleoid? a region in the cytoplasm of bacterial cells where DNA is found a special piece…

A: Nucleoid does not have any membrane that surrounds it and it is irregular shaped space that…

Q: Which of the following statements are correct about inflammation and cancer (select all that apply)?…

A: Inflammation is a defensive response governed primarily by the immune system, which dispatches white…

Q: b. This cross yields the progeny of the following phenotypes. Write the genotype of each progeny…

A: The shuffling of genes (alleles) between chromosomes is referred to as recombination. This allows…

Q: BasH II Kpnl Dra TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT…

A: Many people agree that one of the 20th century's most significant contributions to molecular biology…

Q: Write the basic information of different types of rats or mice( at least 7 and add their pictures).…

A: 1- House mouse (Mus musculus) Color: black or dusty gray. Weight : 0.75oz Length : 6 to 7 inches.…

Q: Why can more organisms tolerate higher concentrations of sugar than salt? Please explain from both…

A: Introduction:- Organisms habitat that contain an excess of carbohydrates in the form of sugar are…

Q: the implications of being able to identify phenotype and behavior correlations in different species…

A: Phenotype is the set of observable characteristics of an individual resulting from the interaction…

Q: Use the following information to answer the next question. The Canada lynx has a diploid number of…

A: Chromosome is an elongated thread like structure which is present inside the nucleus of the cell. It…

Q: do Daphnia magna have a closed circulatory system.

A: Daphnia Magna also known as the water flea, belongs to the phylum Arthropoda. These organisms have a…

Q: Which numbers in the diagram represent where aerobic cellular respiration occur? 3 and 5 O2 and 3 2…

A: Respiration is basically metabolic process in which glucose is degraded and ATP is liberated. It is…

Q: Which statement about metabolic pathways is false? OA. A specific enzyme catalyzes each…

A: Metabolic pathways are set of reactions catalysing conversion of one substrate into some product.…

Q: 2) Concerning the figure below. $. 24 ACC GGGUA - AUG 17 lif UAA A) Which process is being…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum make…

Q: Which of the following statements concerning glycogen in different tissues is TRUE?   a.   Liver…

A: <!--<SUB-PART>--> (a) <!--<SUMMARY-INTRODUCTION>--> To Determine: If the…

Q: Which one of the following is not the type of evidence used in a traditional classification of…

A: Introduction  Animals are eukaryotic, multicellular organisms that are members of the Animalia…

Q: what are the downsides of homologous recombination?

A: Ans: Homologous recombination is the exchange of genetic information between the two identical…

Q: You are part of a group of researchers examining the survivorship and fecundity of Bengal Tigers…

A: Animals are illegally poached all over the world for fun or for their body parts. Over the last…

Q: It is often stated that excess mortality (in general) is higher in low socioeconomic populations.…

A: Mortality rate It is a measurement of the number of deaths (or deaths related to a particular cause)…

Q: List the classification of fatty acids based on their chemical structures, as well as their…

A: Introduction :- The building blocks of fat in our bodies and the food we eat are called fatty acids.…

Q: Consider the maternal effect gene that controls snail coiling where D= dextral, dominant,…

A:

Q: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino…

A: 1.The transcribed sequence would stand as: 5' GGU ACG UUG GGG CUC CAU 3'. The amino acid sequence…

Q: Why can't insulin be given per os? Please explain

A: Insulin cannot be taken by mouth because it is digestible. Oral insulin would be digestible by the…

Q: Which statement best describes the reason maternal recessive CYP1A1 polymorphisms of CYP1A1 decrease…

A: Answer: ...It increases the metabolism of nicotine.  ...It increases the metabolism of PAHs.

Q: Chlamydia are pathogenic bacteria that must be grown within a eukaryotic host cell. They rely on the…

A: Introduction:- Chlamyadiaceae are obligate intracellular bacterial pathogens that strictly depend on…

Q: 7. Using the diagram on the left, the molecule coded directly from DNA is represented by what…

A: Instead, the DNA is used to create a messenger RNA (mRNA) molecule, which then controls the…

Q: 9. which of the following is an example of quantitive data? A)the freshman class of the students…

A: Introduction:- data represent the various types of discrete values which provides information about…

Q: Despite their multiple adaptations, amphibians are still restricted to moist environments. Which are…

A: Amphibians are tiny vertebrates that require moisture to survive, such as water. Frogs, toads,…

Q: This is an example of? a.) fibrous roots b.) tap roots c.) adventitious roots d.) prop roots

A: Fibrous roots are thin and heavily branched roots that arise from bottom of the plant stem.…

Q: DNAT  A  C        C  G  C     T  C  C       G  C  C       G  T  C       G  A  C      A  A  T…

A: The self-replicating biomolecules  that are present in the chromosomes and carry genetic information…

Q: Discuss the control of gene expression in eukaryotes. keep it short plz

A: gene expression: It is a process of transcription of a gene into mRNA, processing of mRNA and…

Q: Use the following information to answer the next question. Meiosis. Chromosome Content of Human…

A: The process of combining the male gamete, or sperm, with the female gamete, or ovum. The product of…

Q: Rank these species in terms of their relatedness to crocodiles. Place the most closely related on…

A: Introduction :  Phylogeny is the study of the organisms with respect to its evolution and the…

Q: 2. *REQUIRED 1 A somatic cell in an organism develops a DNA mutation. This mutation is a beneficial…

A: The genetic traits are those which are transferred from parents to their offspring. Heritable traits…

Oogenesis

The formation of the ovum (mature female gamete) from undifferentiated germ cells is called oogenesis. This process takes place in the ovaries (female gonads). Oogenesis consists of three stages known as the multiplication phase, growth phase, and maturation phase. 

Cell Division

Cell division involves the formation of new daughter cells from the parent cells. It is a part of the cell cycle that takes place in both prokaryotic and eukaryotic organisms. Cell division is required for three main reasons: