Building and using DNA Motifs Background Sequence motifs are short, recurring (meaning conserved) patterns in DNA that are presumed to have a biological function. Often they indicate sequence-specific binding sites for proteins and other important markers. However, sometimes they are not exactly conserved, meaning some mutations can happen in a motif in a particular organism. Mutations can be DNA substītutions/deletions/insertions. Therefore, sequences are usually aligned and a consensus pattern of a motif is calculated over all examples from organisms. The following are examples of a transcription factor binding (TFB) site for the lexA repressor in_ E. Coli _located in a file called lexA.fasta: >dinD 32->52 aactgtatataaatacagtt >ding 15->35 tattggctgtttatacagta >dinH 77->97 tcctgttaatccatacagca >dinI 19->39 acctgtataaataaccagta >lexA-1 28->48 tgctgtatatactcacagca >lexA-2 7->27 aactgtatatacacccaggg >polB (dinA) 53->73 gactgtataaaaccacagcc >recA 59->79 tactgtatgagcatacagta >recN-1 49->69 tactgtatataaaaccagtt >recN-2 27->47 tactgtacacaataacagta >recN-3 9-29 TCCTGTATGAAAAACCATTA >ruvAB 49->69 cgctggatatctatccagca >303C 18->38 tactgatgatatatacaggt >303D 14->34 cactggatagataaccagca >sulA 22->42 tactgtacatccatacagta >umuDC 20->40 tactgtatataaaaacagta >uvrA 83->103 tactgtatattcattcaggt >uvrB 75->95 aactgtttttttatccagta >uvrD 57->77 atctgtatatatacccagct Each line that starts with ">" is the header that states what gene this sequence was upstream of and where it is located relative to the gene. (For your purposes, we can ignore this and your code should ignore these lines when parsing the DNA sequences in). Each line in between is each nucleotide sequence of each TFB. Each nucleotide has a position in the sequence. You can assume that all sequences will be the same length. You also can do very minimal input error checking -I won't be checking extensively for input error checking. However, do make sure that if a function relies on another function being run first, you have it do that. Creating DNAMOTIF class You will create a DNAMOTIF class that has the following attributes and functions: 1._init_(self): Initialize the class. self.instances=[] #These are a list of DNA sequence strings (no header) self.consensus=[] # A DNA sequence String self.counts= {'A': [], 'C': [1, 'G':[],'I':[]} # A dictionary of nucleotide counts 2. _str_ Return a string with the sequence instances of the motif on each line 3._len_: Return the length of a motif, which is the length of one of the sequences in the collection. Example Input: lexA=DNAMOTIF () lexA.parse ("lexA.fasta") print (len (lexA) ) Output: 20 4. parse(selfilename): read in DNA instances from a FASTA file Example Usage: lexA.parse ("lexA.fasta") print (lexA)