What did you learn from this image? Bonding between complementary basesWeak hydrogen bonds form between complementarybase pairs.The hydrogen bonds hold the two strands of nucleotidestogether and maintain the double helix shape of DNA.C pairswith GHydrogen bonds are not asstrong as chemical bonds.This means they can beeasily broken by heat.If DNA is exposed to high heat,the hydrogen bonds betweenthe strands break and theA pairswith Tmolecule loses its structure.

DNA (deoxyribonucleic acid) is the genetic material of almost all living organisms. It is a double…

Bonding between complementary bases Weak hydrogen bonds form between complementary base pairs. The hydrogen bonds hold the two strands of nucleotides together and maintain the double helix shape of DNA. C pairs Hydrogen bonds are not as strong as chemical bonds. This means they can be easily broken by heat. with G If DNA is exposed to high heat, the hydrogen bonds between the strands break and the A pairs with T molecule loses its structure.

Bonding between complementary bases Weak hydrogen bonds form between complementary base pairs. The hydrogen bonds hold the two strands of nucleotides together and maintain the double helix shape of DNA. C pairs Hydrogen bonds are not as strong as chemical bonds. This means they can be easily broken by heat. with G If DNA is exposed to high heat, the hydrogen bonds between the strands break and the A pairs with T molecule loses its structure.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 18QP: Replication involves a period of time during which DNA is particularly susceptible to the...

See similar textbooks

Similar questions

One strand of DNA has the base sequence 5'-CATG-3' Draw this stretch of DNA, showing BOTH strands, using a simplified model of a nucleotide as shown: Label the sugar-phosphate backbone, the 5' and 3' ends of each strand, and the regions of hydrogen bonding.
There is a chemically synthesized DNA oligonucleotide is 5’–AUCG–3’. Pleasedraw the all-atom structure of this RNA strand, including that of the phosphategroup, the pentose (ribose), and the base for each nucleotide. The structure is inthe 5’→3’ direction
The hydrophobic effect explains why: O Water regulates pH in the interstitial fluid between eukaryotic cells. O Salt bridges form between oppositely charged histones and DNA in an aqueous environment. Nitrogenous bases are in the interior of the helix, when DNA is in an aqueous environment. Oil forms a homogenous mixture with polar solvents, like acetone.
Which of the following changes occur with a double-stranded DNA if it is heated to 95 C at neutral pH? OA Increase in the absorption of uitraviolet light at 260 nm OB. Unwinding of the helical DNA structure Oc Separation of the two DNA strands Do.Hydrolysis of the N-glycosidic bond belween the base and deoxyribose DE Breakage of the phosphodiester bonds belwean adjacent ucieotides Dr. Breakage of the hydrogen bonds between guanines and cytidines.
What is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGAT
the DNA consists f 2 strnds hold together by which bond?
STRUCTURE OF DNA Ueing the complementary base pairing rules in DNA, complete the following base pairs: Adenine - Cytosine -i Guanine -i Thymine - : Adenine : Cytosine :: Guanine :: Thymine 1
One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base sequence of the complementary strand. 5'- What special type of sequence is contained in this DNA segment? Hoogsteen pairing major groove O palindrome mirror repeat What alternative structure does the double-stranded DNA have the potential to form? B-DNA O a G tetraplex triplex DNA a cruciform Z-form DNA
Phosphate T Sugar G G A 4 Bases O CCCACTTGAG GAGTTCACCC GGGTGAACTC CTCAAGTGGG O None of the Above Suppose the DNA molecule shown at left was produced in the test tube from deoxynucleotide 5'-triphosphates. What is the correct primary sequence of this piece of DNA?
a. Write the structural formula of GAC, a portion of DNA. Write the complementary strand adjacent to it so that the complementary bases are side by side. Connect the appropriate base pairs. b. Sticking to the convention of writing the nucleotide sequence in the 5'-3' direction, what is the nucleotide sequence of the DNA strand complementary to ATGCACCATGCT?
Z-DNA derives its name from the zig-zag conformation ofphosphate groups. What features of the DNA molecule allowthis distinctive structure to form?
What is the melting temp. of the following double-stranded DNA fragment CATCGCGATCTGCAATTACGACGATAA GTAGCGCTAGACGTTAATGCTGCTATT