1:58 l 5GE Done 21 of 23 In order to model osmosis, students created an artificial cell using dialysis tubing (a thin membrane that water can pass through but that sucrose cannot) and a solution made of sucrose (a type of sugar) dissolved in water. The students filled the dialysis tubing with the sucrose solution, tied the open ends of the tube, and placed the artificial cell in a beaker containing distilled water. Artificial Cell Water Sucrose Which of the following correctly identifies whether the sucrose solution is hypertonic or hypotonic, shows the net movement of water, and predicts what will happen to the size of the artificial cell over time? Time A Hypotonic Solution HO Time В -Нурotonic Solution HO Time Hypertonic Solution HO Time D Hypertonic Solution

1:58 l 5GE Done 21 of 23 In order to model osmosis, students created an artificial cell using dialysis tubing (a thin membrane that water can pass through but that sucrose cannot) and a solution made of sucrose (a type of sugar) dissolved in water. The students filled the dialysis tubing with the sucrose solution, tied the open ends of the tube, and placed the artificial cell in a beaker containing distilled water. Artificial Cell Water Sucrose Which of the following correctly identifies whether the sucrose solution is hypertonic or hypotonic, shows the net movement of water, and predicts what will happen to the size of the artificial cell over time? Time A Hypotonic Solution HO Time В -Нурotonic Solution HO Time Hypertonic Solution HO Time D Hypertonic Solution

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

You obtain two segments of dialysis tubing with large pores. You fill two large beakers with distilled water. In beaker A, you place a dialysis bag (bag A) containing a 1% solution of a protein called Tiny. In beaker B, you place a dialysis bag (bag B) containing a 1% solution of a protein called Dinky. After two hours, you recover the bag contents and the beaker contents and perform a biuret assay. The results of the assay are shown below. What can you conclude about the relative sizes of Tiny and Dinky?
*Short Response*
1. Which substances are able to diffuse through dialysis tubing? Choose all that apply. - Protein - Glucose - Sodium chloride - Starch 2. In yeast, which culture(s) are able to demonstrate diffusion? (Choose one option below) A) Only the dead yeast culture demonstrated diffusion B) Both the alive and dead yeast culture demonstrated diffusion C) Only the alive yeast culture demonstrated diffusion D) Neither the alive nor dead yeast culture demonstrated diffusion 3. In yeast, which culture(s) demonstrate active transport? (Choose one option below) A) Only the alive yeast culture demonstrated active transport B) Neither the alive nor dead yeast culture demonstrated active transport C) Only the dead yeast culture demonstrated active transport D) Both the alive and dead yeast culture demonstrated active transport 4. In yeast, adenosine triphosphate (ATP) does not provide the energy for active transport to occur (True or False?) A) True B) False
add 9.9mL of sterile medium to give you a Dilution Tube #2. What is the concentration of bacterial cells in Dilution Tube #1 and Dilution Tube #2? 5. ( ts). Here is a hypothetical gene showing the sequence of DNA nucleotides for the template strand (note: the template strand is the strand that is transcribed). This sequence includes the regions that code for start and stop codons in translation as well as introns and exons. The Introns are indicated by UNDERLINED NUCLEOTIDES. Coding Strand of DNA: +1 Box2 (-25) 3' ....TATAAA........ TACTCGATAGCCGAATGTCTTC CTCAGAC TAA... 5' a) Describe the role of the following in transcription of this DNA strand: a. RNA Polymerase b. Promoters c. Transcription factors d. Initiation, elongation and Termination of the pre-mRNA strand b) Transcribe the above DNA into a pre-mRNA Molecule c) You have just transcribed the above molecule of messenger RNA in the nucleus of a human cell. What types of modifications will occur to this RNA before it leaves the…
Bacteria, viruses and fungi plowton 5.3K views Bacteria How to revise plowton 158 views Do less workand 9:52/9:52 * YouTube Minimize Video Questions: a. Diffusion is the movement of solutes in an aqueous solution, and it is a(n) passive process. b. What statement best describes diffusion? movement of solutes froi c. Osmosis is the movement of Water in an aqueous solution, and. it is a(n) [L3-2bb] process. d. A hypertonic solution will have more of solutes than a hypotonic one. e. Movement of water by osmosis across the plasma membrane in a cell will be from hypertonic to hypot f. True or false - both animal and plant cells can burst if too much water enters via osmosi False
When the yeast cells have completely re-hydrated, measure out 1.8 mL of well-mixed yeast suspension (0.2% yeast) into each of two new 15 mL centrifuge tubes. Add 200 μL of a 10% (w/v) Sodium Azide*** in YGM solution to one of the 15 mL tubes with yeast suspension. Add 200 μl of YGM to the other 15 mL tube of yeast suspension for your Control. Let both tubes incubate at room temperature for 30 min, vortexing every ~5 minutes What is the % concentration of azide in this sample during metabolic inhibition?What is the % concentration of yeast in this sample during metabolic inhibition?
=quires Respondus LockDown Browser Time Left:0:55:57 Abdulla Salem: Attempt 1 E) 20 kilocalories per gram of wax burned Question 36 (2 points) lons can travel directly from the cytoplasm of one animal cell to the cytoplasm of an adjacent cell through O A) gap junctions. B) intermediate filaments. C) plasmodesmata. D) desmosomes. E) tight junctions. Question 37 (2 points) A. C. В. H. H H-C-N H. H-C-SH H-C H. H. H H hp