Below are the DNA sequences that encode the first eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that differ from the first sequence are shown by a lowercase letter. ATGTCTCTCACCAACAAGAACGTC ATGgCTCTCACCAACAAGAACGTC ATGTCgCTCACCAACAAGAACGTC ATGTCTtTgACCAACAAGAACGTC ATGTCTCTCACCAACAAGAACGTg a. What are the first eight amino acids for each of these five DNA sequences? b. For each of the five polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism. c.The fourth sequence shown above has two mutational differences from the first sequence. Specifically, the third codon is TTG versus CTC in the first sequence. These two codons are two mutational steps away from each other. Supposing that the CTC sequence gave rise to the TTG sequence, do you think it is more likely that the one-difference intermediate was TTC or CTG? d. In general, synonymous polymorphisms tend to be more common than nonsynonymous polymorphisms. Why might that be?
Below are the DNA sequences that encode the first eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura.
ATGTCTCTCACCAACAAGAACGTC
ATGgCTCTCACCAACAAGAACGTC
ATGTCgCTCACCAACAAGAACGTC
ATGTCTtTgACCAACAAGAACGTC
ATGTCTCTCACCAACAAGAACGTg
a. What are the first eight amino acids for each of these five DNA sequences?
b. For each of the five polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism.
c.The fourth sequence shown above has two mutational differences from the first sequence. Specifically, the third codon is TTG versus CTC in the first sequence. These two codons are two mutational steps away from each other. Supposing that the CTC sequence gave rise to the TTG sequence, do you think it is more likely that the one-difference intermediate was TTC or CTG?
d. In general, synonymous polymorphisms tend to be more common than nonsynonymous polymorphisms. Why might that be?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
