Q: show me what the clade of banana and grape would look like
A: The term clade is associated with a collection of all the living and extinct members of that…
Q: 2. Restriction Enzyme Mapping - use any resources to assist you including the hints below. A…
A: Focus only on EcoR1. Than focus on EcoR1 and HindIII. Than focus on EcoR1, HindIII and Pst1
Q: Which of the following is false about disease burden?
A: The term "communicable diseases" refers to illnesses that can spread from one person to another via…
Q: Describe the structure and composition of viruses. What are three reasons that they are different…
A: In nature there are many ultra microscopic particles known as viruses. A virus is small particle…
Q: Porcupines have 34 chromosomes. If a specific porcupine has 5 heterozygous chromosomes, how many…
A: The development of reproductive cells causes various genes to separately separate from one another,…
Q: Drugs and other medicine uses the concept of signaling. Cite some drugs how they mimic natural…
A: There are a few important points : Receptors : They are chemically protein and glycoprotein which…
Q: Your short answer should be 2-5 sentences depending on the question. (Ch. 55). Please answer both…
A: Most ecosystems have only 3 or 4 trophic levels. Some believe that humans should consume plants…
Q: Where did you answer the last 2 questions?
A: 5'UTR stands for untranslated region at the 5' end of the DNA sequence. 3' UTR stands for…
Q: buttressing system. Different skull functions show species developments. What different activities…
A: Ho.o habilis and homo erectus were archaic humans. Homo habilis lived around 2.4 million years ago…
Q: What generally happens to individual expenditure(private meaning for the individual person, not the…
A: To make health for all a reality, there is a need of individuals and communities who have access to…
Q: frequencies for a single gene with two alleles for three different populations.…
A: According to Hardy Weinberg equilibrium equation- p2 + q2 + 2pq =1 and p + q =1 Where, p =…
Q: What causes ALS (i.e. mutation, chromosomal alterations, epigenetics, other)?
A: Amyotrophic lateral sclerosis(ALS) An estimated 5 to 10 percent of ALS cases are familial, meaning…
Q: How to measure the muscle strength and muscle mass by using the anthropometric assessment
A: Anthropometric measurements provides the quantitative measurements of the body. This assess the…
Q: How has the significance of science knowledge changed over the centuries from the point of view of…
A: Scientific knowledge is crucial to our understanding of the world around us and how it works. It…
Q: 4. Compare and contrast ESCs and iPSCS by considering the following: B) List two ethical…
A: Stem cells: The human body is composed of multiple cell types that perform various functions. One…
Q: What is a common feature of the voltage sensitive Ca++, Na+ and K+ ion channels? A single…
A: The structure of Na+, K+, and Ca2+ channels is made up of four transmembrane domains arranged around…
Q: A 55 year old man who is overweight, a heavy drinker and habitual smoker is brought in to the…
A: When choosing an imaging modslity for detection of ischemic stroke, there are two choices, magnetic…
Q: Use the following information to answer the next question. a. In Drosophila (fruit flies), a gene…
A: 1. Natural selection, gene flow, and other factors in a population can alter allele frequencies over…
Q: 4.08 2.54 H Note: E E 1.02 1.02 1.67 H = EXON = INTRON AE E 10.8 kbp 3.94 3.66 E = EcoRI site H =…
A: Autoradiography is a method that visualizes molecules or fragments of molecules that have been…
Q: Concerning interface drug reactions, which statement is false? a. Most are caused by type II…
A: Dyskeratosis: Clinically characterized by the trio of aberrant nails, reticular skin pigmentation,…
Q: In eukaryotes, fatty acids are stored as triglycerides in cells that have A) Golgi that store fatty…
A: In eukaryote, fatty acids are stored as triglycerides in cells with Golgi that store fatty acids.…
Q: 2. What general conclusions can you derive from the data as to the effect of soil enrichment on the:…
A: Introduction Soil enrichment is a fertiliser catalyst that increases the effectiveness of…
Q: What occurs during food digestion? O Energy in large molecules is used to make ATP. O Energy from…
A: The process through which the food we eat moves through our bodies for the formation of new cellular…
Q: Describe how you can determine if the gene is interrupted, and if so the number of interruptions by…
A: Gel electrophoresis is a technique in which macromolecules such as DNA, RNA or proteins are broken…
Q: 5. A patient receives a donor kidney to replace diseased kidney tissue. Consider and answer the…
A: In a kidney transplant, a healthy kidney from a living or deceased donor is surgically implanted…
Q: 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61 tcggcggccc tggccctgac…
A: Annotating a genome involves finding functional components throughout its sequence in order to give…
Q: Summarize the evidence regarding the sum of evolutionariy modifications from the given putative…
A: Evolution is the gradual change in the inherited traits of biological populations over many…
Q: Describe the body’s natural defenses in each of the body systems. Identify the role played by the…
A: The human body has its natural defenses which protect the body from various barriers and external…
Q: : What role does the environment play in addressing the needs of society? Question 2: Do you…
A: Q1 Environment can be summed up as the effects of all the living and non living…
Q: When a neurotransmitter-filled vesicle is in the primed position, which t-SNARE connect is critical…
A: Synapses are structures or junctions that facilitate the passing of an electrical or a chemical…
Q: week when I mutated the SSA1 gene in yeast it made cells grow faster, but made them sensitive to…
A: Hypertrophy is the increase in cell size. Single gene exerting its effect on more than one trait is…
Q: STRETCH BAND LATERAL RAISES Bones Muscles Joint type(s) Movement(s) Name an activity you could do in…
A: Your breathing and heart rate will increase during endurance or aerobic exercises. They enhance your…
Q: Patrick the starfish and his friend Susie the sand dollar are both members of the
A: Patric the starfish and Suie the sand dollar are anime characters from the animated series SpongeBob…
Q: Instructions Explain 1 way each of the following can occur. In your answer, say whether non-…
A: the sperm carries Y, so non-disjunction occurs in mother, If the X chromosomes failed to separate…
Q: What is the resultant ionic movement when stereocilia move towards the tallest kinocilium? Efflux of…
A: Introduction : Around the hair cells of the inner ear are two different kinds of fluid. The fluid…
Q: Use the following information to answer the next question. Some Events that Occur During Meiosis 1…
A: There are two kinds of cell division: mitosis and meiosis, mitosis is the most common way of making…
Q: Describe the changes in the brain that lead to the excess dopamine activity and the behavioral…
A: A condition that impairs a person's capacity for clear thought, feeling, and behavior. It may…
Q: How do you differentiate a nodule from a root gall?
A: Abnormal outgrowths of plant tissues and can be caused by nematodes is gall and nodule is formad by…
Q: 2. Sahelanthropus tchadensis Similarities and differences with other hominins
A: Evolution is a continuous transition of living forms, beginning with the basic forms of the past and…
Q: Please explain whether CAR T-cells alter tumor cells expressing gasdermin -B, -E and -D when anti-…
A: Gasdermin is protein in humans, implicated in human response. It comprises six types in human, that…
Q: List down 10 warm-up exercises for badminton. Specify by Name of exercise , counting, target…
A: Warm-up exercises can help to prepare the body for physical activity by increasing blood flow to the…
Q: Snowy owls are large white birds that normally inhabit the cold northern regions of Canada.…
A: 1. As the food web shown in figure is interconnected, many species will be affected by introduction…
Q: Biologists have identified 4 kinds of small molecules: adenine, cytosine, guanine, and thymine,…
A: Introduction Gene is the fundamental genetic component transferred from parent to child. Genes are…
Q: 2. Using a reference, find the function of smooth muscle tissue in humans and one would find it.…
A: The hollow body organs like the bladder, colon, and stomach all contain smooth muscles. They are…
Q: The simple act of covering the nose and mouth with a tissue when coughing or sneezing is an…
A: Introduction: Our reflexive ability to cough serves to shield our lungs and airways from irritants.…
Q: Based on the data shown in the pie charts (from DiFilippo et al. 2010): Gut microbiome richness is…
A: Species diversity is the variety of species found within a region. Species diversity has two…
Q: Rickets is the result of: a lack of vitamin D. high UV exposure. a lack of melanin. severe air…
A: The disease is a state which is deviated from healthy state. The health is defined as the…
Q: Some groups of bacteria can go dormant during periods of environmental stress through the formation…
A: Under stressful environments, some single-cell organisms like bacteria undergo a period of dormancy…
Q: how the Dual-energy-X-ray absorptiometry(DXA) and hydrostatic weighting to estimate the percentage…
A: Dual-energy-X-ray absorptiometry (DXA) for measurement of fat. DXA determines not only the precise…
Q: QUESTION 5 Which of the following cells are not found in the intestinal crypts of the small…
A: The crypts of Lieberkuhn are the tubular glands that lie between the finger-like projections of the…
Outline the three major mechanisms of cell fate determination in developmental genetics.
please help me to write 600 word essay.
Step by step
Solved in 3 steps
- Brainbow is a genetic approach to fate mapping developed to label cells with a seeming rainbow of possible colors, which can be used to identify each individual cell in a tissue or even a whole embryo. Give the mechanics behind this technique. What are its applications to the field of Biology in general, and to Developmental Biology in particular?What is the basic flow of genetic information in all cellular life ? Include in your answer a the steps in the flow of genetic information and a brief definition for each .Below are the DNA sequences that encode the first eight amino acids for five alleles of the Adh protein in Drosophila pseudoobscura. Nucleotides that differ from the first sequence are shown by a lowercase letter. ATGTCTCTCACCAACAAGAACGTC ATGgCTCTCACCAACAAGAACGTC ATGTCgCTCACCAACAAGAACGTC ATGTCTtTgACCAACAAGAACGTC ATGTCTCTCACCAACAAGAACGTg a. What are the first eight amino acids for each of these five DNA sequences? b. For each of the five polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism. c.The fourth sequence shown above has two mutational differences from the first sequence. Specifically, the third codon is TTG versus CTC in the first sequence. These two codons are two mutational steps away from each other. Supposing that the CTC sequence gave rise to the TTG sequence, do you think it is more likely that the one-difference intermediate was TTC or CTG? d. In general, synonymous polymorphisms tend to be more common than nonsynonymous…
- All the cells of one organism share the same genome. However, during development, some cells develop into skin cells while others develop into muscle cells. Briefly explain how the same genetic instructions can result in two different cell types in the same organism.Mutations in the HPRT1 gene in humans result in atleast two clinical syndromes. Consult OMIM (www.omim.org) by querying HPRT1; you will only needto look briefly at the top three hits (files #300322,300323, and 308000).a. What is the full name of the HPRT1 enzyme?b. On which chromosome is the HPRT1 gene located?c. Mutations in HPRT1 are associated with two different syndromes. What are these syndromes? Foreach, answer the following questions: (i) What arethe symptoms associated with the syndrome? (ii) Isthe mutant allele that causes the syndrome dominant, recessive, codominant, or incompletely dominant with respect to the normal allele, or do specialconditions apply? (iii) Is the syndrome associatedwith a loss-of-function or a gain-of-function disease allele? (iv) Does the syndrome display allelicheterogeneity? (v) Does the syndrome display locus heterogeneity? (Note: You do not need to understand everything in the OMIM entries to answerthese questions.)For the first experiment ever on Drosophila mutations. Answer the following questions. a. What is the title of the first published paper explained the experiment and what is the name of the Author? b. What is the first mutation discovered in Drosophila? c. Explain the changes in the Drosophila yellow mutant (Y)compared to wild type.
- Huntington disease (HD) is an inherited neurodegenerative disorder characterized by gradual, irreversible impairment of psychological, motor, and cognitive functions. Symptoms typically appear in middle age, but onset can occur at almost any age, and the course of the disease can range from 15 to 20 years. The molecular basis of HD is becoming better understood, and the genetic mutation has been traced to a gene that encodes a large protein of unknown function. In individuals who will not develop HD, a region of the gene that encodes the N-terminus of this protein has a sequence of CAG codons (for glutamine) repeated 6 to 39 times in succession. In individuals with adult-onset HD, this codon (3 nucleotides) is typically repeated 40 to 55 times In those with childhood-onset HD, it is repeated more than 70 times. *codon: refers to the 3 nucleotides that code for amino acid. A small portion of the coding sequence of the HD gene is given below. The nucleotide sequence of the DNA is…Briefly discuss why mutant allele 1 fails to produce functional protein. Note that this mutation has no impact on the length of the mRNA transcribed from the gene.Duchenne Muscular Dystrophy (DMD) is a disorder that primarily affects the function of skeletal muscles used for movement and cardiac muscles used for heart beating. Dystrophin is a protein encoded by a single gene, DMD, that is expressed in skeletal and cardiac muscle. Some forms of muscular dystrophy may be caused by different mutations in the DNA sequence of the DMD gene. Because the DMD locus is on the X chromosome, males are affected at higher rates. Two brothers, one of whom has DMD and one of whom does not, worked with their genetic counselor (Links to an external site.) to have their DMD gene sequenced to identify genetic variation that may explain why one brother was affected and the other not. Because DMD is a very long gene, a fictionalized, simplified model of the results is presented here (Figure 1). The actual DMD mRNA is about 16,000 base-pairs!------Consider single nucleotide polymorphism (SNP) #1 (Figure 1). Is this mutation likely to cause Duchenne muscular…
- Leber Congenital Amaurosis (LCA) causes progressive vision loss due to defects in the gene that encodes RPE65 isomerase. Affected individuals are homozygous recessive for mutant alleles of the RPE65 gene. You are trying to determine the molecular nature of the mutations in three individuals with LCA. For ease of analysis, you may assume that each individual is homozygous for the same mutant allele (though the three individuals have different mutations than each other). You use the polymerase chain reaction to amplify DNA from each patient and you determine the sequence of the DNA and compare it to unaffected individuals. You identify the following differences. Note that the non-template strand of DNA is given and the changes are highlighted using red boldface. You can assume that the sequences are in the first reading frame (eg. the first three nucleotides of each sequence is a codon). The coding region of the gene is 1602 bp and the position of the sequences shown below is…Prader-Willi syndrome and Angelman syndrome are both caused by deletion of a set of genes onchromosome 15. The symptoms of Prader-Willi syndrome are short stature, small hands andfeet, hypotonia (floppiness), hypogonadism, mild mental retardation, and an uncontrollabledesire to eat (polyphagia). Angelman syndrome is characterized by an intellectual anddevelopmental delay, sleep disturbances, seizures, hand-flapping and other jerky movements,frequent laughter or smiling, and usually a happy demeanor.Please explain how the deletion of the same set of genes can result in such different diseases. Inyour answer, be sure to discuss the role of genetic imprinting and epigenetics.1). In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the brain, resulting in seizures, blindness, decline in cognitive function and motor skills, dementia, and death by the late teens or early 20’s. The TPP1 gene is 6695 bp in length. Think about the characteristics of Batten disease, and then suggest an approach to gene therapy that might be effective for this specific genetic disorder. You may assume that your research team is working in the U.S. and your research is funded by a grant from the National Institutes of Health (NIH). Please EXCLUDE the use of CRISPR from consideration. A. Will you use germline or somatic cell gene therapy? Please NAME and DEFINE the form of gene therapy selected, then explain WHY this is the most appropriate choice.