Bacteria and other microbes can be used to "clean up" an oil spill by breaking down oil into carbon dioxide and water. Two samples isolated from the Deepwater Horizon leak in the Gulf of Mexico were labeled A and B. The DNA of each was isolated and the percent thymine measured in each sample. Sample A contains 19.3% thymine and sample B contains 27.9% thymine. Assume the organisms contain normal double-stranded DNA and predict the composition of the other bases. percent adenine in sample A: percent guanine in sample A: percent cytosine in sample A: percent adenine in sample B: % A %G %C %A
Q: Which of the following is not a catabolic fate for pyruvate formed in glycolysis? fermentation to…
A: Pyruvate is the end-product of glycolysis. It is ultimately transported into the mitochondria and…
Q: Which of the following shows the structure of aspartic acid at pH 11? a H₂N. ОН ОН b H₂N ОН с H₂N ОН…
A: Aspartic acid (Asp or D); ionic form is known as aspartate, is an α-amino acid that is used for the…
Q: If the hydrolysis of 1 M glucose 6-phosphate catalyzed by glucose 6-phosphatase has a ΔG′∘ of…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: There are some cells in our bodies (stem cells) that are able to form new structures even in adults.…
A: Stem cells are undifferentiated cells In our body that can turn into any specific cells, as per the…
Q: How do R groups constrain the potential conformations of a protein?
A: As per the central dogma of molecular biology, DNA contains the code that is necessary for the…
Q: F.28. How will phosphorylation of serine change the pKa of Arg, increase, decrease, or no change
A: Serine is a polar but uncharged residue. Arginine is a basic residue due to the presence of an amine…
Q: Which statement is false for transition-state analog enzyme inhibitors? They fit the active site…
A: Transition state analogues are used as enzyme inhibitors. They bind competitively to the active site…
Q: 3. Supra-secondary structures of proteins - supercoiled alpha- helix, Greek key, meander, interlock,…
A: Protein: The amino acids are arranged in a long chain and joined to one another by covalent peptide…
Q: An uncompetitive inhibitor interacts with the enzyme•substrate complex to form a ternary complex…
A: Enzyme inhibition is a process by which the activity of an enzyme is altered. Inhibitors are…
Q: 16) Region A 17) Region B A) nonpolar B) neither
A: A biological membrane has lipids as an essential component. It includes phospholipids and…
Q: Which of the following statements is/are TRUE about the Lock and Key model of enzyme-substrate…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: How many of the following statements are true? Allosteric enzymes display sigmoidal kinetics for…
A: Allosteric enzymes are enzymes that possess additional binding sites known as allosteric sites.…
Q: Explain IN DETAIL the reactions and processes of alcoholic and lactic acid fermentation. Include…
A: The process of cellular respiration leads to catabolism of pyruvate after the glycolytic pathway.The…
Q: Consider the each of the amino acids in the peptide below.…
A: Amino Acids: Although the liver is the primary location for amino acid metabolism, other organs…
Q: Wheeler Johnson Principle: Reagents: Reaction: Substance Detected: Murexide Principle: Reagents:…
A: DNA/RNA are nucleic acids, the molecules responsible for carrying genetic information from one…
Q: Draw the following Lipids in: A) Condensed (detailed) Structure, B) its Block Diagram. C)…
A: Phospholipids are compound lipids composed of fatty acid, alcohol, nitrogen containing molecules,…
Q: The metabolic amino acid ornithine is a direct precursor of the polyamine putrescine, shown here. +…
A: Ornithischians is a metabolically active non proteogenic amino acid so that it would not be…
Q: Zoey Wong is a research officer at the Department of Biosciences of Tunku Abdul Rahman University…
A: The basic principles of the central dogma of molecular biology is similar in both prokaryotic and…
Q: Explain the function(s) of each of the basal transcription factors (the TFII "alphabet soup")
A: Basal transcription factors are required for the initiation of the transcription or mRNA synthesis.…
Q: Please explain why hydrolysis of ATP can release much energy by describing how the products of ATP…
A: ATP hydrolysis is the catabolic reaction process in which chemical energy that is stored in the…
Q: Use the relationships revealed by a Lineweaver-Burk plot and the table of enzyme performance to…
A: Parameters such as Km and Vmax are used for comparing enzyme activities. If we know the initial rate…
Q: fredrickson's classification of hyperlipidemia (tubular format)
A: Familial hypercholesterolemia (FH) has an HLP2A (Frederickson type IIa) lipid profile. Fredrickson…
Q: *The enzyme glucose oxidase isolated from the mold Penicillium notatum catalyzes the oxidation of…
A: Carbohydrates are polyhydroxy aldehydes or ketones. They can be classified as monosaccharides,…
Q: The following are coenzymes or cofactors involved in enzymatic reactions. Identify the biochemical…
A: Enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes are…
Q: Briefly describe the role and location of each cofactor/coenzyme involved in the pyruvate…
A: Pyruvate is the end product of glycolysis. Under aerobic conditions, pyruvate is oxidised into…
Q: Name three metabolic processes in the cell that are enhanced and two that are inhibited in response…
A: Insulin is a peptide hormone released by the beta cells of the pancreas. The key function of insulin…
Q: The dissociation of lactic acid to lactate is shown in the reaction. Lactic acid has a pKa of 3.86.…
A: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch equation: pH =…
Q: Given the following enzyme-catalyzed reaction, identify the class and subclass of the enzyme…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group that is…
Q: Why might the compound shown below act as a transition state analog of phosphoglucose isomerase? A…
A: Phosphoglucose isomerase (PGI) is an enzyme belongs to class of isomerase enzyme which catalyzes…
Q: A binding curve for the binding of the amino acid tryptophan to the protein called TxtE is shown…
A: The binding of ligand 'L' to a protein 'P' to form Protein-Ligand complex 'PL' is represented…
Q: Which is most negative at a pH of 7 Tyr-Lys-Met Gly-Pro-Ara Asp-Trp-tvr V Asp-His-Glu Leu-Val-Phe…
A: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal amino acid on…
Q: Component 1 PCR buffer 2 MgCl2 3 dNTP mix 4 SSR forward primer 5 SSR reverse primer 6 Taq polymerase…
A: PCR is also known as a polymerase chain reaction which is generally used to amplify the template DNA…
Q: (Multiple coenzymes on the left may match to the same reaction on the right. Some reactions on the…
A: Co enzymes are the molecules that help in accelerating the reaction rate or helping the enzyme to…
Q: The second high energy intermediate metabolite of glycolysis that can be used for substrate level…
A: Nonessential amino acids can be synthesized in the body in which the cells provide the carbon…
Q: What is DNA? Provide a 5-sentence long description only.
A: Nucleic acids, large macromolecules are necessary for all organisms and viruses to function. The…
Q: Your friend has a mutation in their aldehyde dehydrogenase gene, causing it to be inactive. Based on…
A: Aldehyde dehydrogenase is an enzyme involved in alcohol metabolism and detoxification of aldehydes…
Q: Use the table below to answer the question being asked: Protein Ovalbumin Insulin Fibrinogen…
A: Sodium Do-decylSulphate PolyAcrylamide Gel Electrophoresis (SDS PAGE) is a method used to separate…
Q: You are studying a protein, MSPaintase, which you suspect is a trimer composed of three different…
A: In size exclusion chromatography, species gets separated based on their size. The beads with pores ,…
Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…
A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…
Q: Identify the type of inhibition (competitive, noncompetitive, uncompetitive) 1 Enzyme B Inhibitor…
A: Introduction: Enzyme kinetics involves the study of the rate of chemical reactions increased by a…
Q: 1. The second high energy intermediate metabolite of glycolysis that can be used for substrate level…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: The PI of protein P is 7.3. One can purify protein P by:
A: The proteins are composed of twenty naturally occurring amino acids that are linked vis peptide…
Q: 1 2 3 4 5 6 N Sample Lysate Name volume 8 Tilapia Cod Sole Perch Tilapia Cod Sole 2 μl Perch 10 με 2…
A: Protein sample: A non-branching sequence of amino acids joined together by a single peptide bond…
Q: How do you compute quantum yield (Φ) and what does the value tell you about the plant?
A: Photosynthesis is a process that converts light energy into chemical energy. A photochemical…
Q: 1. Create a summary chart with the following headings: Macromolecule; Indicator; Positive Result…
A: Introduction: Lipids are biological macromolecules that are soluble in nonpolar solvents and…
Q: What is the purpose of inverting (or siding up) an inoculated plate when we place it inside…
A: The incubator is used for the incubation of Petri plates. Petri plates are used to grow the…
Q: What are the repurposing drugs used for treating parskinson disease?
A: Introduction: Parkinson's disease is a degenerative brain disorder that was first described by…
Q: Transfer to PRPP Please show mechanism steps and arrow pushing.
A: Nucleophiles are electron donating groups . They participate in biochemical reactions by donating a…
Q: Draw the catalytic triad of a serine protease at the first tetrahedryl intermediate stage. Your…
A: Serine proteases cleaves peptide bonds of protein substrates. They are called serine proteases…
Q: Mabelle used the pET vector system to express her prokaryotic amylase enzyme. She added IPTG into…
A: In expression and purification of protein from bacterial system, the following steps are performed:…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Bacteria and other microbes can be used to "clean up" an oil spill by breaking down oil into carbon dioxide and water. Two samples isolated from the Deepwater Horizon leak in the Gulf of Mexico were labeled A and B. The DNA of each was isolated and the percent thymine measured in each sample. Sample A contains 19.3% thymine and sample B contains 27.9% thymine. Assume the organisms contain normal double-stranded DNA and predict the composition of the other bases. percent adenine in sample B: percent guanine in sample B: percent cytosine in sample B: Both samples are then denatured to remove the secondary structure. Which will have the higher temperature to denature? A B % A %G %CElectrophoresis is an extremely useful procedure when applied to analysis of nucleic acids as it can resolve molecules of different sizes with relative ease and accuracy. Large molecules migrate more slowly than small molecules in agarose gels. However, the fact that nucleic acids of the same length may exist in a variety of conformations can often complicate the interpretation of electrophoretic separations. For instance, when a single species of a bacterial plasmid is isolated from cells, the individual plasmids may exist in three forms (depending on the genotype of their host and conditions of isolation): superhelical/supercoiled (form I), nicked/ open circle (form II), and linear (form III). Form I is compact and very tightly coiled, with both DNA strands continuous. Form II exists as a loose circle because one of the two DNA strands has been broken, thus releasing the supercoil. All three have the same mass, but each will migrate at a different rate through a gel. Based on your…You are trying to determine the base content for a number of samples in the lab (mouse DNA, bacterial DNA, single-stranded DNA virus and double-stranded RNA virus). Unfortunately, you failed to use an alcohol-proof marker and during the ethanol precipitation of your samples the labels came off the tubes. You finish the experiment anyway and try to use the data to determine the samples. Can you determine the source of each sample based on your results? Briefly explain how you come to your designations. Sample % adenine % cytosine % guanine % thymine % uracil A 18 32 32 18 0 B 26 18 32 24 0 C 31 19 19 0 31 D 10 40 40 10 0
- The following image is of an agarose gel. If DNA samples were loaded to this gel and the electrophoresis experiment was started, explain what would happen and why.A DNA sample contains 21% adenine. What is the complete percentage base composition?Which of the following are possible base compositions for double- stranded DNA? O A=30% G=20% C=20% T=30% U=0% O A=20% G=35% C=35% T=20% U=20% O A=30% G=20% C=35% T=15% U=0% O All are correct
- You have purified plasmid DNA, and observed the following absorbances: A260 = 2.9 A280 = 2.2 If A260 of 1.0 = 50 µg/ml pure dsDNA. Which of the following can you conclude? Select all that apply The concentration of your plasmid DNA is 145 ng/ul. The concentration of your plasmid DNA is 110 ng/ul. The plasmid DNA purity is acceptable. The plasmid DNA purity is not acceptable.Is the DNA you extracted is pure? What are the possible impurities? What can we do with the DNA once we have purified it? Discuss different techniques and technologies associated with this. Imagine that there is an E. coli outbreak in your area, and you would like to test the kangkong from your local grocery store. How could you modify this protocol to extract DNA from the kangkong (to identify the species) and check for presence or absence of E. coli.? Keep in mind that (i) E. coli is free-living and not an endosymbiont, and (ii) plant cells are encased in both a cell membrane and cell wall.You have begun your career in medicinal biochemistry and have just discovered a bacterial DNA plasmld (transferabl ring of DNA) that appears to destroy the Ebola virus. In order to characterize your new plasmid, the molar mass of the plasmid must be determined. You dissolve 25.00 mg of the purified plasmid in 0.200 mL of water at 2 °C and find the osmotlc pressure of this solution is 1.20 Torr at 20 °C and 1 atm pressure. Answer the following about the Ebola-killing plasmid. 33.) The osmotlc pressure of the system is: (a) 1 atm (b) 0.016 atm (c) 6.5 X 10-5 atm (d) 22.59 atm (e) 0.0016 atm
- A DNA sample contains 21% adenine. What is its completepercentage base composition?Dr. Wakefield would like to isolate recombinant plasmids from her bacterial culture using the alkaline lysis method. She is planning to use the chemicals as listed below: Solution I: 50 mM glucose, 25 mM Tris-Cl (pH 8.0), 10 mM EDTA (pH 8.0) Solution II: ??? Solution III: 5 M potassium acetate, glacial acetic acid, de-ion water Ethanol 70% (v/v) Isopropanol TE-RNAase pH 8.0 (i) (ii) (iii) Based on the chemical list above, state the content(s) of Solution II. Explain the functions of Solution II described in Q3 a) (i) in plasmid isolation. What is the role of alcohol precipitation conducted after the plasmids are obtained at the end of the procedure? Discuss the roles of ethanol and salt in alcohol precipitation step.IF A DOUBLE-STRAND DNA SAMPLE WAS COMPOSED OF 10 PERCENT THYMINE, WHAT WOULD BE THE PERCENTAGE OF GUANINE?