Assuming a protein is present in the cell at 1 µM concentration, how many copies of that protein are present (on average) in a 1 µm3 volume (roughly the volume of a bacterium)? b. What is the corresponding volume per molecule in nm3? c. If the protein were approximately spheres with diameter 5 nm, what fraction of the volume would the protein (still at 1 µM) occupy? d. Repeat part a of this question, but now with concentration 1 nM. e. Repeat part a of this question, but now for a yeast cell (assume yeast cell is a sphere with diameter 5 µm)..

Q: Name the three major assumptions made by the "Cell theory". (i) The lipid membrane is composed of…

A: The "Cell theory" is a fundamental principle in biology that describes the basic characteristics of…

Q: Q3. (a) What does the diagram on the next page show? (b) Name a cellular macromolecule in which this…

A: Enzymes posses the ability to  bring about various forms of change to their substrates. This change…

Q: 5) Using FRAP (Fluorescence Recovery After Photobleaching), you can measure the diffusion rate of…

A: FRAP (fluorescence recovery after photobleaching) is a method to determine the diffusion kinetics…

Q: Using the answer code below, indicate which type of ribosome is being described: A. free ribosome B.…

A: The main function of ribosomes is the synthesis of proteins this process is called translation.…

Q: Technique by which proteins are separated by [Choose] electrophoresis according to their charge.…

A: Techniques by which proteins are separated by electrophoresis according to their charge- Gel…

Q: FACILITATED DIFFUSION a. What is the importance function of facilitated diffusion in the Human Body?…

A: Facilitated diffusion is the movement of substances through a biological membrane from an area of…

Q: Explain the binding problem.

A: The brain is one of the organs of the central nervous system, along with the spinal cord. It is…

Q: i. Why are carbon, nitrogen, oxygen, and hydrogen the most abundant elements in living matter and,…

A: Carbon, hydrogen, oxygen and nitrogen possess the low atomic numbers hence forms a stronger bonds to…

Q: How much of a 10 mg/ml DNase stock would you need to add to 4 mL of cells for a final concentration…

A: DNA  ( deoxyribonucleic acid ) is a two stranded helical structure that functions as genetic…

Q: Define constant region

A: The Immune system comprises a network of specialized cells, tissues, proteins and organs that acts…

Q: A researcher is isolating proteins from a cell via different techniques. They find that when the…

A: Establishing protein expression is important in the study of cells, because proteins often carry out…

Q: Decide whether each molecule in the table below could be found embedded in the outer surface of a…

A: Cell membranes are mostly composed of phospholipids. An important characteristic of phospholipids is…

Q: d. Which types of amino acids could you expect to find on the exterior of transmembrane proteins…

A: The environment in the interior of the lipid bilayer of the membrane is hydrophobic in contrast to…

Q: Or. Fayez Sar The volume enclosed by the plasma membrane of plant cells is often much larger the en…

A: Plants and animals are both eukaryotic beings, yet they differ structurally and functionally. The…

Q: The cis golgi compartment ______. Options: A)  is a convenient place to store tools in small…

A: The Golgi apparatus is an organelle present in most eukaryotic cells. It is made up of…

Q: Youtube link: https://youtu.be/9bPto2f_fGA After watching it, please ANSWER THE QUESTIONS! The…

A: Osmosis refers to the process of passive movement of molecules through a semipermeable membrane. The…

Q: Read This! When phospholipids are added to an aqueous environment (consisting mostly of water) the…

A: Introduction  Cells are box or chamber-like structures containing fluid cytoplasm enclosed by…

Q: Using the the enzyme acid hydrolase in the lysosome: What is the final destination in which the…

A: In eukaryotic cells various proteins function specifically within certain organelles. Such proteins…

Q: Part a) Would a single alpha helix be more stable in a aqueous solution or a membrane. Explain why.…

A: The secondary structure of proteins is referred to as the regular, recurring arrangements of…

Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?

A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…

Q: a. You selectively label phospholipids with a fluorescent dye and perform the FRAP assay. You detect…

A: FRAP is a method to determine the diffusion or kinetics of the biomolecule through tissue or cells.…

Q: The diffusion rate of four different membrane proteins (A, B, C, and D) was measured using a FRAP…

A: Here we are trying to figure out the relative mobility of 4 proteins in the phospholipid bilayer of…

Q: Order following for rate of diffusion through a synthetic lipid bilayer. Explain your order.…

A: Transport across the plasma membrane is a highly regulative process that is dependent on both the…

Q: For each protein, identify the following: If the protein is an integral, peripheral, or amphitropic…

A: * Integral monotopic proteins will permanently attached to membrane from one side only then it is…

Q: The cell membrane is both fluid and asymmetrical. Discuss asymmetry of the plasma membrane, as well…

A: The cell membrane is a thin, flexible, and selectively permeable layer that surrounds the cells of…

Q: \ctivity D: Osmosis in an Onion Cell this activity you will observe what happens to onion cells when…

A: The cells are the structural and functional unit of an organism that perform all the physiological…

Q: Mild, non-ionic detergents (like Triton X-100, with polar but uncharged regions that do not denature…

A: Mild, non-ionic detergents are commonly used for the solubilization and separation of membrane…

Q: Sassa, a biology professor, wanted to demonstrate to her students the applicability of a dialyzing…

A: Dialysis is a traditional laboratory technique that uses selective diffusion of molecules across a…

Q: Order following for rate of diffusion through a synthetic lipid bilayer. Explain your order.   K+,…

A: Permeability is the term used to describe how fast the molecule is able to diffuse through the…

Q: 25. Your friend works in a cell biology research lab. She is working she calls p125, because its…

A: High salt wash disrupts the ionic bonds that are present generally between most peripheral proteins…

Q: 1. What do the top/bottom of this diagram refer to? It refers to 2. What are the two major groups of…

A: Cellular respiration is divided into two types- aerobic and anaerobic respiration. Aerobic…

Q: Shown below are cells (colored) that were recently placed into a beaker containing a clear solution…

A: facilitated diffusion occurs down the concentration gradient from high to low concentration by a…

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.