Q: 16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid…
A: The genetic code is a set of rules used by living cells to translate information encoded in genetic…
Q: 6. A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCTGCTGACGCTGCTCGTCG-3'…
A: mRNA, or messenger RNA, is a type of RNA molecule that plays a central role in the process of…
Q: 2. The following double stranded segment of DNA is part of a protein coding gene. The segments in…
A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…
Q: 2. Given a DNA template molecule of 5'- ATGGCTCCTACCTACTAGTTAACATATGG-3', generate the mRNA sequence…
A: We are given a sequence of DNA in 5'-3' direction. We have to generate the mRNA sequence and then a…
Q: 3. List the sequences for the "stop" codons.
A: A codon is a three-nucleotide long stretch present in the messenger RNA (ribonucleic acid). It codes…
Q: Identify the term being asked by the statement: a. It describes mRNA that results in a single…
A: The RNA is produced from the DNA by the transcription process and the mRNA is used for the protein…
Q: For the Central Dogma of Molecular Biology: I in the LINES with: Protein, Primary mRNA, Active…
A: Introduction Central dogma in molecular biology is the process by which the instructions in DNA are…
Q: 1. What is the concept of universality of the genetic code? What are the exceptions to this…
A: Introduction The sequence of nucleotides on m-RNA that code for an amino acid is known as genetic…
Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…
A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…
Q: List the amino acid sequence of the protein coded for.…
A: The translation is the process of synthesis of amino acids from the mRNA. During the translation…
Q: 3. A missense mutation results in the presence of a different amino acid than was encoded by the…
A: Sickle cell anaemia is an autosomal recessive disorder.
Q: 3. The DNA sequence of a gene coding for a short polypeptide is TACGCTAGGCGATTGACT. What would be…
A: Transcription is a process of formation of mRNA from DNA, whereas tranlation is a formation of…
Q: 10. List three examples of stop codons. a) .. b) .... c)
A: Genetic code It is a dictionary that corresponds with sequence of nucleotides and sequence of amino…
Q: ow many amino acids will the mRNA sequence "AUG GAC CUG UCG A" produce? (LS1-1) *
A: Amino acids production.
Q: mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3. a) Using the genetic code, provide…
A: DNA is the store house of genetic information, DNA is transcribed into mRNA through the process of…
Q: Build" the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly, letter by…
A: The process of RNA synthesis with the help of template strand of DNA is called transcription. It is…
Q: 30. How can one identify the presence of introns in a hybrid of DNA and mRNA? Give an example of…
A: Introns are non-coding sequences, whereas exons are coding sequences. Splicing is the process of…
Q: 16. Consider the following original coding sequence of a gene that codes for a short 3-amino acid…
A: DNA is a self replicating molecule. The process by which mRNA is produced from DNA is called…
Q: 1. TRUE OR FALSE a) Eukaryotic mRNA contains the message from the DNA for the synthesis of one…
A: In polycistronic mRNA the mRNA can encode several proteins and is characteristic of many bacterial…
Q: 11. Transcription is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d)…
A: Gene is the structural and functional unit in the DNA. Genes are composed of nucleotide nitrogenous…
Q: 3. The average molecular weight of human proteins is about 50,000 daltons. A few proteins are much…
A: The molecular weight of the normal protein and titin protein are given. We need to determine the…
Q: 1.List three different mRNA sequences that could encode the amino acid sequence…
A: Amino acids are the building blocks of polypeptide and proteins. The process of making of…
Q: What does it mean for genes to be "conserved"?
A: In this question, we have to explain mean to be genes to be ''conserved ''.
Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…
A: DNA => Transcription => mRNA => Translation => Protein. Given : Non-template strand…
Q: . What is the nucleotide sequence of the complementary strand of the DNA molecule:…
A: DNA or deoxyribose nucleic acid is the genetic material for most organisms. It is a polymer of…
Q: dentify and define three sections of the eukaryotic gene.
A: A gene is a structural and functional unit of heredity. Gene is made up of DNA. It is that region of…
Q: TGTACACATGTCCGAAACAGACTTACCGAA-5
A: For the given DNA Sequence , the translated mRNA is as follows_ 3'TGTACACATGTCCGAAACAGACTTACCGAA5'…
Q: 6. Similar to the class notes (Intro to Genetics), a segment of DNA (shown below) contains a…
A: Hi! Thank you for the question. since you have not mentioned which part you are looking for, so we…
Q: 1. A DNA base sequence transcribed into messenger RNA in the following sequence:…
A: Introduction :- Transcription is the process through which synthesis of mRNA molecules takes place ,…
Q: 1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand:…
A: Transcription is the process of synthesis of mRNA by using a template DNA strand. Translation is the…
Q: Describe the basic structure of a gene.
A: Gene is the region of DNA that encodes proteins and a trait. While each gene is composed of two…
Q: protein-coding gene
A: Transcription is defined as the process of copying a segment of DNA into RNA. Translation is defined…
Q: 1. A portion of the template strand of a DNA molecule that codes for the 5'-end of an mRNA has the…
A:
Q: 7. If you have aligned orthologous gene sequences from an important, conserved gene; there is a…
A: When two species diverge into two separate species, the copies of a single gene in the two resulting…
Q: 1. The following is the DNA sequence of a gene: 3' TACTAACTTAGCCTCGCATC 5' a. What amino acids are…
A: Non sense codons are stop codons which lead to termination of translation. These are - UAA, UAG,…
1. Please describe the structural components of a gene?
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- 1.List three different mRNA sequences that could encode the amino acid sequence histidyl-alanyl-arginyl-seryl-leucyl-valyl-cysteine.1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)1. List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
- 11. Transcription is the flow of information from: a) DNAàDNA b) DNAà mRNA c) mRNAà polypeptide d) polypeptideà amino acids3. The average molecular weight of human proteins is about 50,000 daltons. A few proteins are much larger, such as a muscle cell protein called titin, which has a molecular weight of 3,000,000 daltons. B) If the nucleotides in the coding portion of the mRNA constitute 5% of the total nucleotides that are transcribed, how long will it take a muscle cell to transcribe a gene for an average protein versus the titin gene. Assume that the transcription rate is 50 nucleotides per second.1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.
- 6. How many amino acids will the mRNA sequence "AUG GÁC CUG UCG UGA" produce? (LS1-1) * Second mRNA base G UUU Phe UUC UCU UAU UGU Tyr UAC Cys UCC Ser UCA UGC C Phe Gly (G) Leu UAA Stop UGA Stop A Glu (F) (L) UUA Leu UUG Ser Asp (E) (D) (S) Tyr (Y) UCG UAG Stop UGG Trp GUC Ala CUU (A) A CCU CAU CGU His CUC Leu CUA CC Pro ССА CAC CGC Arg CGA Cys (C) Val CAA Gln CAG G U (V) G Trp (W) CUG CCG CGG Arg (R) G U A C A C Leu AUU ACU AAU Asn AGU Ser AGC (L) Ser (S) C AUC Ile ACC AAC Thr Lys (K) UG A AUA Pro AGA Arg AGG ACA AAA Lys AAG Asn (N) (P) AUG Met or start ACG His Thr (H) (T) Gln GUU GCU GAU Asp GAÇ GGU (Q) lle Arg (R) (1) GUC Val GUA GCC Ala GCA GGC Gly GGA GAA Glu OGAG GUG GCG GGG O 1 3 4 First mRNA base (5' end of codon) - U A GUca Gbc AG Third mRNA base (3' end of codon)12. The flow of genetic information usually takes place from a) RNA to DNA to proteins b) proteins to RNA to DNA c) DNA to RNA to proteins d) none of these4. A mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3. a) Using the genetic code, provide the amino acids specified by the mini mRNA. b) Label the two ends of the short peptide.
- 1. A portion of the template strand of a DNA molecule that codes for the 5'-end of an mRNA has the following nucleotide sequence. Give the primary structure of the polypeptide (use 3-letter amino acid codes), beginning with the most common translation initiation codon, that will be specified by this portion of the gene. Be sure to label the ends of the polypeptide. 3'-TTTTACGGGAATTAGAGTCGCAGGATG-5'Describe the basic structure of a gene.1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.
![Biology: The Dynamic Science (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)
![Biology: The Dynamic Science (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)