Anfinsen studied protein folding using RNaseA.

Q: B14. The last two amino acids added to a polypeptide are - Trp - Glu - (C terminus). The last two…

A: To determine the last two anticodons used in the translation of the given polypeptide sequence, we…

Q: A lysine is on the surface of a protein, near an aspartate. How does the aspartate alter the pKa of…

A: The pKa of an amino acid's side chain determines whether it is protonated (+) or deprotonated (-)…

Q: In the: Exposure to a substance that mutates the Shine-Dalgarno sequence. Explain: (a) What is the…

A: (a) Shine-Dalgano sequences are ribosomal binding site in bacterial or archeal messenger RNA. So if…

Q: How did they get GCC to GUC? and AAC to AAU?

A: The mutation is the change in the sequence of nucleotides in DNA. The sequence of nucleotides in DNA…

Q: Based on image of protein (enzyme), need to know: a) Number of amino acids and length (Angstroms)…

A: We are given the tertiary structure of a protein (enzyme). Here; the grey spheres indicate carbon…

Q: 2.5 Which of the following is true about translation? A) The anticodon in the transfer RNA is…

A: t- RNA is called transfer RNA which changes to amino acyl RNA with help of the aminoacyl t-RNA…

Q: List the two mechanisms found in cells that selectively alter protein shape?

A: Mature proteins essential for the cell, which perform several functions such as in cell it acts as…

Q: How does the aminoacyl-tRNA synthetase that attaches the amino acid proline know which tRNA to…

A: tRNA is a small, well-characterized RNA molecule which plays a key role in protein biosynthesis.…

Q: 5'-ATGGAATTGGCATGGTTTACCCGTGATGGT-3' 3-ТАССТТААСCGTACCAAATGGGCACTACСА-5'

A: TRANSITION MUTATIONS  These are mutations that occur due to the substitution of a pyrimidine base by…

Q: A group of researchers isolate 'Protein X' from the wall of a human stomach with the intent of…

A: The protein is an extremely complex substance which consist of amino acid residues jointed by…

Q: Actinomycin D inhibits DNA-dependent RNA synthesis. This antibiotic is added to a bacterial culture…

A: Antibiotics are isolated from microorganisms (bacteria). They use antibiotics to inhibits the growth…

Q: What are the A site and the P site? How are their roles in protein synthesis similar? How do they…

A: The protein is a principle component of all the cell. It is an organic compound that is made of one…

Q: Consider the following peptide sequence: Met-Ser-Val-Thr-Ile-Lys-Ala-Cys-Leu-Ser-lle-Tyr-Phe-Ser…

A: Structure of a protein or a peptide is described in four levels: primary, secondary, tertiary and…

Q: Would a chimeric translation system containing thelarge ribosomal subunit from E. coli and the small…

A: The chimeric translation system is the translation process that uses two different ribosomal…

Q: Translation requires energy what step(s)? please explain answer B) 30S ribosome subunit binding C)…

A: Translation is the process that involves production of polypeptide chain from the mRNA (messenger…

Q: Which ribosomal subunit has the catalytic function for polypeptide biosynthesis? O a) the mRNA Ob)…

A: The larger ribosomal subunit, also known as the 50S (or 60S in eukaryotes) subunit, is liable for…

Q: A mutation that changes an alanine to a leucine in the nucleus of a protein leads to a less active…

A: Introduction: Each organism's DNA sequence is unique. Its base-pairs sequence can change from time…

Q: Which amino acid would be attached to a tRNA that read "GGU"? Val (M) Ala (A) Ser (S) 3'- Arg (R) A…

A: Amino acids are the structural unit of proteins, that is made up of carbon, hydrogen, Oxygen and…

Q: Use the sequence from the pre-mRNA shown below to answer the following question.…

A: Introduction :  The GU (5' splice site) and AG (3' splice site) recognise splice sites, signalling…

Q: A point mutation occurs in the middle of the coding sequence for agene. Which types of…

A: Mutation is the process of abrupt changes in the nucleotide sequence or gene in the DNA. Mutation…

Q: What effect will phosphorylation have on the behaviour of a protein on a 2D gel? 1. The spot…

A: Phosphorylation is the post translation modification of proteins. Phosphorylation generally occurs…

Q: (a)In conjugates_ determines the specificity of the enzyme (b)Protein biosynthesis is a complex…

A: Enzymes are the catalyst for the biochemical reaction. It helps in increasing the rate of reaction…

Q: C) We looked at three serine protease enzymes: elastase, chymotrypsin, and trypsin. All three…

A: The enzyme which helps in the digestion of elastin and release by the pancreas is called elastase.…

Q: Which of the following would base pair with an aminoacyl tRNA? Question 33 options: A) 5'-UGA-3'…

A: Aminoacyl-tRNA is tRNA to which it's cognate amino acid is chemically bound. The Aminoacyl-tRNA…

Q: As we focused on the translation of mRNA into proteins as well as on protein structure and function.…

A: One gene one enzyme hypothesis, proposed by Beadle and Tatum, says that each enzyme produces a…

Q: e: 5 factor that does not dissociate from the RNA polymerase Holoenzyme in: (a) What is the process…

A: Sigma factors are responsible for determining the specificity of promoter of the DNA.

Q: you were given an unknown peptide. Explain in detail how you would determine the amino acid sequence…

A: The amino acids that form the protein are mostly L forms. The carboxyl group of amino acids in the…

Q: The synthesis of a peptide is given by the mRNA sequence 5'GAAGAGAAACUUACU3', Find the primary…

A: The 'Central Dogma' is the process by which the instructions in DNA are converted into a functional…

Q: The following polynucleotide was synthesized and used as a template forpeptide synthesis in a…

A: Three consecutive nucleotides form a triplet termed a codon that codes for a single amino acid.…

Q: Trace the pathway of a protein from translation to the plasma membrane. You may name this protein…

A: Membrane proteins are a part of membrane structure, which are very important for a cell to carry out…

Q: The Shine-Dalgarno sequence binds to sequence within the large ribosomal subunit so that ribosomes…

A: in order to address the question, we'll first weigh out each option to arrive at the correct option.…

Q: Explain the experiment used to determine the structure of ATCase. What happens to the activity and…

A: Since it is the most well-studied allosteric enzyme, aspartate transcarbamoylase, which catalyses…

Q: E. coli ribonuclease H1 is an enzyme that catalyzes the hydrolysis of phosphodiester bonds in RNA.…

A: Carboxylate relay One of the carboxylates ( Asp70) activates water molecule to release the hydroxyl…

Q: Assume that the translational error frequency, δ, is 1 x 10–4.(a) Calculate the probability of…

A: mRNAs are used to form protein by translation. The translation is performed using ribosomes, t-RNA…

Q: Erk and P-Erk live in two different locations within the cell even though they are just two…

A: * Mitogen activated protein kinase also called as  MAPK and  p42MAPK, and ERK2 * It is an enzyme…

Q: Given the following DNA sequence: 5'ATTGGCTGTTAAAACCGGTGCCTGGGCATCGTTGGA3' Part A Write the mRNA…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…

Q: Assume that the translational error frequency, 8, is 1 × 10-4. (a) Calculate the probability of…

A: The translation is the process of making a polypeptide chain from mRNA. The translation is catalyzed…

Q: How many moles of ATP and GTP are required to synthesize a mole of a polypeptide 100 amino acids…

A: In protein biosynthesis, amino acids are activated by the binding of a specific tRNA molecule and…

Q: s of RNA and briefly explain their functional significance. In what reaction(s) do they participate?

A: Classification of RNA and DNA based on molecular size and function is vital to understand genetic…

Q: question

A:

Q: Why is a b-barrel as opposed to a b-sheet optimal for a transmembrane protein?  Think about the…

A: Transmembrane proteins are found on the cell membrane and connect the exterior and interior cell…

Q: Human ribonucleotide reductase has two allosteric sites, the S site and the A site. What is the…

A: Human ribonucleotide reductase in a mammalian enzyme that is responsible for the conversion of RNA…