Analyze the following amino acid sequence and write down a potential mRNA sequence from which this sequence might have been translated. Use the codon table in your book to determine a possible mRNA sequence.  Amino Acid Sequence 1: H3N+-Methionine-Valine-Histidine-Leucine-Threonine-Proline-Glutamic Acid-Glutamic Acid-COO- (a) Consider Amino Acid Sequence 2. How is Amino Acid Sequence 2 different from Amino Acid Sequence 1? Amino Acid Sequence 2: H3N+-Methionine-Valine-Histidine-Leucine-Threonine-Proline-Valine-Glutamic Acid-COO- (b) Write a potential mRNA sequence for Amino Acid sequence 2, using the same codons for any given amino acid if it is present in both sequences.

Q: Using the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA…

A: Transcription is a process of formation of transcript or RNA from DNA by the process of…

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Determine whether this statement is true or false: Aminoacyl-tRNA synthetase covalently links the…

A: Transfer RNA, often known by the acronym tRNA and formerly known as soluble RNA (sRNA), is an…

Q: Now we need to know which amino acid the tRNA is carrying. We can do this on paper using the…

A: Strand mRNA codon tRNA anti-codon AA(short) AA(full name) Strand1: C-G-T-T-A-T-C-T-C-A-T-A-G-C-T…

Q: Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the…

A: Each codon is made up of three nucleotides, each of which corresponds to a single amino acid. The…

Q: How does initiation of translation occur in prokaryotes? Include a discussion of the ribosomal…

A: Like transcription, the process of translation also involves three successive stages- initiation,…

Q: Draw a simple schematic of a tRNA molecule showing its two "business" ends.

A: t-RNA is a type of RNA molecule that is clover leaf like in structure. It is known as transfer RNA.

Q: Bacteria Eukaryotes First amino acid 5' end 3' end Cistron Introns/exons

A: Bacterial and eukaryotic m-RNA is different from each other in bacterial translation first amino…

Q: Name the enzyme responsible for binding of aminoacid to trna?

A: Ribonucleic acid (RNA) is a biomolecule that plays important role in coding, decoding, and…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide…

Q: What is the name of the enzyme is responsible for transcribing the DNA sequence into mRNA? In your…

A: Trascription is the process by which the information on DNA is transferred to a molecule of RNA.…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Describe the steps (Initiation, Elongation and Termination) involved in translation of mRNA to…

A: All the living cells are made up of protein, which acts as building blocks for every organism. These…

Q: What does tRNA stand for?

A: The central dogma is the theory explaining the process of gene expression that initiates from the…

Q: Suppose that there is an unknown protein that underwent Edman sequencing method. From N- terminal…

A: Sequencing of proteins is done by treating Proteins with different enzymes that have specificity in…

Q: Use the table of the codons to answer the following question. Starting with the start codon, what is…

A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA molecule that codes for a…

Q: Give typing answer with explanation and conclusion  Which of the triplets below is a possible…

A: Production of protein from the mRNA is known as translation in which tRNA is responsible for…

Q: For each of the following sequences, fill in either the DNA, the mRNA sequence, or the amino acid…

A: The given mRNA sequence: AUG ACU AGC UGG GGG UAU UAC UUU UAG  The corresponding DNA sequence will be…

Q: Part of being a detective is being able to decode secret messages left behind by certain…

A: The given DNA sequence is: 5'- TATGCTAGGCATTGTCGTAGGCATACG -3' 3'- ATACGATCCGTAACAGCATCCGTATGC -5'

Q: Draw the structure of the dipeptide Thr-Cys at pH7. Clearly indicate the following

A: Disclaimer: As per Bartleby guidelines, for questions with multiple sub parts, we will answer only…

Q: 1. Using the table of the genetic code, determine the sequence of amino acids. 2. If mutation occurs…

A: Codons are triplets of nucleotides in the mRNA sequence, which is read by the ribosomes in order to…

Q: Shown below is a portion of a DNA sequence ( 31 base pairs long ) that encodes the last amino acids…

A: The process of synthesis of messenger RNA with the help of template DNA strand is called…

Q: Choose a pentapeptied composed of five different amino acids.  List the five amino acids.…

A: mRNA strand is synthesized from the template strand of the DNA by transcription. This mRNA is…

Q: Here is our DNA sequence: T-A-C-A-T-G-T-T-T-A-G-G-T-C-C-A-C-C-C-G-T-G-G-G-A-C-T Write the RNA…

A: Introduction  The process by which the genome's DNA is copied in cells is known as DNA replication.…

Q: Polycistronic mRNA are common in bacteria but seldom occur in eukaryotes. Describe the key…

A: mRNA which stands for messenger RNA is a molecule responsible for production of amino acid chain…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphate

A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polynucleotides, i.e., they are polymers…

Q: Describe the process where a peptide chain is formen from a code embedded in a nucleic acid…

A: Central Dogma of molecular Biology explain how a DNA replication result into DNA, DNA is changed…

Q: Determine each of the following items using the hnRNA nucleotide sequence (enter the answer using…

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: Name two enzymes/protein complexes in molecular biology that contain both RNA and protein. What…

A: A molecular assembly consisting of both protein molecules and enzymatic components is referred to as…

Q: During planetary exploration a new life form is discovered which has a DNA genome containing 6…

A: A genetic code is defined as the blueprint for the synthesis of proteins. Normally, three nucleotide…

Q: DNA gene TAC AGC TTT mRNA codon (No thymine in RNA!)       tRNA anticodon (No thymine in…

A: According to Bartleby guidelines, the first three questions have been answered. Kindly post the…

Q: Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’…

A: According to Bartleby guidelines, we are required to attempt first three sub-parts in case of…

Q: How many RNA bases are Explain your answer. required to code for a protein that contains 250 amino…

A: Transcription is the process in which one stranded mRNA is synthesized from two stranded DNA…

Q: Below is an mRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz…

A: This mRNA sequence have so many genetic code. There are some numerical value on genetic code but all…

Q: Choose any pentapeptide composed of five different amino acids.  List the amino acids.  Present one…

A: INTRODUCTION In cells, messenger RNA is a molecule that transports information from the nucleus to…

Q: If the template strand of DNA carries the code: GGT-AAT-ACT, then what is the corresponding mRNA…

A: The central dogma of life involves three major steps that include: DNA replication: This is the…

Q: Suppose that there is a protein consisting of two polypeptide chains with the given sequences in the…

A: Edman degradation, which was invented by Pehr Edman, can be used to determine the amino acid…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.