Add the following to 400ml H2O (not from the tap!)   5.4 g Tris base 50.0ml 10X Boric acid (55.0 mg/ml) 2.0ml 0.5M EDTA solution   Adjust the final volume to 500ml with additional H2O, transfer to a bottle and label it as you will need this next week. Calculate the molarity of the tris, boric acid and EDTA in the 1X solution (to 2 decimal places).

Q: 4

A: Given :- Cu-Ni alloy contains 64 wt% Cu and 36 wt% Ni. wt% of Cu in liquid is 54% and in solid is 3...

Q: 1.08 g H2 is allowed to react with 9.83 g N2 , producing 1.36 g NH3 . Part A What is the theoretical...

A:

Q: Draw the skeletal structure corresponding to the systematic name of the molecule: 4, 5, 5 - triethy...

A: Given :- systematic name of compound =  4, 5, 5 - triethyl- 2, 2, 4, 6 - tetramethylheptane  To draw...

Q: how much heat will be given off when 18.5g of C2H4 is burned in oxygen form CO2(g) and H2O(g) for th...

A: The combustion enthalpy of C2H2 of 18.5 g can be calculate with the help given stoichiometric equati...

Q: H. ОН PCC .COOH COOH or Na,Cr,0/ OH HNO, or HOAC KMNO, or NaOCI Cyclohexanol bp 161.5°C, den. 0.96 M...

A: The required mechanism is shown below Here initially oxidation of secondary alcohol to a ketone occ...

Q: complete total synthesis of Delta9 THC (all the steps of the mechanism).

A: Total synthesis of Delta9 THC: Total synthesis: Total synthesis is the complete chemical synthesis o...

Q: How many molecules of water occur per formula unit of MgSO4. Write the complete formula of the hydra...

A:

Q: Balance the given molecular equation using redox (electron-transfer method). Identify the element ox...

A:

Q: Problem 48 - IR spectrum Problem 48 C10H200 40- MW = 156 35- 30- 25- 20- 15- CDC1; 10- 3500 3000 250...

A:

Q: Identify the peaks and structer.

A: 13C-NMR shows an non-equivalets of the carbons in the spectrum. The number of signals in the spctrum...

Q: Write the ionization constant expression for a 50 mM aniline solution (pKb=9.40 @ 25 C).

A:

Q: Consider the following table: Name Formula Conjugate Acid 1.8 x 10 5 4.38 х 10 4 NH3 NH,+ Ammonia Me...

A: For best buffer solution pH of the solution should be equal to pKa of acid.  For effective buffer so...

Q: Problem 20 - IR spectrum Problem 26 100- C;H10,Br MW = 238 80- 60- - CDCI; 40- - CDCI; 20- 3500 3000...

A:

Q: 2. Meanwhile, Jenny is given 250 mL of solution which is 0.0376 N Magnesium iodide from a pure solid...

A:

Q: 1.08 g H2 is allowed to react with 9.83 g N2, producing 1.36 g NH3. Part A What is the theoretical y...

A:

Q: 1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show...

A:

Q: Estimate the λmax of the following organic compounds. Show your solutions and/or analysis.

A:

Q: Balance the following chemical equation (if necessary) for the combustion reaction of propane: C3H8(...

A: In multiple questions we solve only first question according to Bartleby guidelines. Balance the ele...

Q: This is the excessive bending of bonds exhibited by a carbons at the point of rotation which creates...

A: Strain arises due to the repulsion between the bond electron of the molecule . So the molecule are a...

Q: pka E

A:

Q: Suppose a 3.00 L scuba tank is filled with about 29.7 moles of air at the ocean surface. If the tank...

A:

Q: O Parap Build a С Нow N Co x G Eleme bc46d6c41bbfdf9#10001 E Reading list 15 of 21 Review| Constants...

A:

Q: 5) Suggest the reagents required to produce the ff compounds: А. H. - CH3 В. С. :0: air,

A:

Q: 2. What is the mass of KHP that you will weigh? a. The instructions read "Weigh out accurately 700 t...

A: answer :

Q: Complete the table below for calculating the molar mass of the ionic compound chromium(II) sulfide. ...

A: Given, Chromium (II) sulfide.

Q: pH

A:

Q: What is the correct chemical waste of Ammonia and Diethylamine A. Down the sink B. Con...

A: Answer :  

Q: Consider the following equilibrium reaction: C= D and Figure 2 to answer the questions below! c. Why...

A: The answer is as follows:  

Q: What coefficients (in order from left to right) are needed to balance the following chemical equatio...

A: Given, ___Fe2O3(s) + ___C(s) → ___Fe(s) + ___CO(g) Coefficients are needed to balance the above equa...

Q: Reaction of hydrogen and nitrogen to form ammonia Hydrogen gas, H2 , reacts with nitrogen gas, N2 , ...

A:

Q: A certain reaction is first order in N, and second order in H,. Use this information to complete the...

A:

Q: • Which of the following radicals is expected to be the least selective? 1. HO• 2. F. 3. Cl• 4. Br• ...

A: Answer 2 :-  Radical chain chlorination of 2,3-dimethyl pentane :  2,3-dimethylpentane 1 Alkane) rre...

Q: Rubbing alcohol is a commonly used disinfectant and has a cooling effect when applied to the skin. T...

A: Given, Common concentration of rubbing alcohol = 70 % (v/v) Concentration of isopropanol solution us...

Q: Complete the table below for calculating the molar mass of the ionic compound chromium(III) sulfide ...

A: A compound is formed by the electrostatic interaction between the cation and the anion. The cation i...

Q: how much heat Q needs to be supplied to the gas?

A: In this question  wh have to calculate the heat Q needs to be supplied to the gas with teh help of m...

Q: BUFFERS CH3COOH and CH3COONa NH,OH and NH&Cl H3PO4 and NaH2PO4 H2CO3 and NaHCO3 NH3 and (NH4)2CO3

A: Buffers are the solutions which resist the pH change.  Acidic buffer is the mixture of weak Acid/bas...

Q: The pH of pure water at 50°C. is 6.63. At 75°C the pH is 6.35. Compare Kw values at 25°C, 50.°C and...

A: Answer attached below

Q: 3. Propose an efficient synthesis to get the final product using malonic ester Hint: 6 steps to get ...

A: Solution                   If effcient synthesis to get the final product using malonic Ester..

Q: The equilibrium constant, Kp, for the following reaction is 1.57 at 600 K: CO(g) + Cl2(g) coCI,(g) C...

A:

Q: What is the final glycosidic link to be broken during glycogen debranching? a-1,3-glycosidic linkage...

A:

Q: Choose a balanced equation for the combustion of isoprene, CSH8, in an abundant supply of oxygen. Is...

A: • Isoprene gas on combustion reaction in presence of oxygen gas gives carbon dioxide gas and water v...

Q: Activity 2: Identify the intermolecular forces present among the following species. a. Two Sulfur di...

A: There are several types of intermolecular forces like H-bonding,dipole-dipole interaction , ion-dipo...

Q: A block of iron forming a pool of the liquid metal is correctly classified as A) Chemical change B...

A: Physical change : is the change of matter that occurs without change of the chemical composition. It...

Q: Some measurements of the initial rate of a certain reaction are given in the table below. [H] [4] in...

A: Given, [ H2] [ I2] Initial rate M/s 1.00 M 0.881 M 0.392 1.00 M 0.0933 M 0.0415 1.50 M 0.88...

Q: , Kgoal = ?

A:

Q: At a certain temperature the rate of this reaction is first order in NH,OH with a rate constant of 0...

A:

Q: Ka = 1.8 x 10-5 Ka1 = 4.3 x 10-7 HOAC H2CO3 %3D Ka2 = 5.6 x 10-11 Which of the following 0.01 M solu...

A:

Q: Predict the missing reactant of this biochemical reaction: ATP ADP kinase N. That is, in the drawing...

A: In the given reaction we have to predict the starting material. The starting material is shown below

Q: A certain reaction is second order in N, and first order in H,. Use this information to complete the...

A:

Q: Which of the following strategies is NOT used in the regulation of glycogen phosphorylase? O phospho...

A: Glycogen is stored at liver,muscle. Phosphorylation converts inactive form to active form. Regulatio...