If dividing cells are grown in a culture medium containing radioactive thymidine, thethymidine will be covalently incorporated into the cell's DNA during replication.Consider an experiment in which asynchronous cells are radioactively labeled foronly a short period of time (about 30 minutes).The radioactive thymidine medium is then replaced with medium containingunlabeled thymidine, and the cells are grown for some additional time.At different time points after replacement of the medium, cells are examined in amicroscope.The percentage of cells in mitosis (which can be easily recognized because theirchromosomes are condensed) that have radioactive DNA in their nuclei is thendetermined and plotted as a function of time after the labeling with radioactivethymidine. 10075502551015202530time (hours)A. In which phase of cell cycle would cells contain radioactive DNA? Would cells atall phases of the cell cycle contain radioactive DNA immediately after the labelingprocedure? Explain briefly whyB. Why are there initially no mitotic cells that contain radioactive DNA? ExplainbrieflyC. Can you estimate the length of the G2 phase for these cells from the graph?Explain brieflyD. Estimate the length of the total cell cycle for these cells.labeled mitotic cells (%)

Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…

A. In which phase of cell cycle would cells contain radioactive DNA? Would cells at all phases of the cell cycle contain radioactive DNA immediately after the labeling procedure? Explain briefly why B. Why are there initially no mitotic cells that contain radioactive DNA? Explain briefly C. Can you estimate the length of the G2 phase for these cells from the graph? Explain briefly D. Estimate the length of the total cell cycle for these cells.

A. In which phase of cell cycle would cells contain radioactive DNA? Would cells at all phases of the cell cycle contain radioactive DNA immediately after the labeling procedure? Explain briefly why B. Why are there initially no mitotic cells that contain radioactive DNA? Explain briefly C. Can you estimate the length of the G2 phase for these cells from the graph? Explain briefly D. Estimate the length of the total cell cycle for these cells.

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 1CT

See similar textbooks

Similar questions

In a bacterial culture in which all cells are unable to synthesizeleucine (leu-), a potent mutagen is added, and the cells areallowed to undergo one round of replication. At that point, samplesare taken, a series of dilutions are made, and the cells areplated on either minimal medium or minimal medium containingleucine. The first culture condition (minimal medium) allowsthe growth of only leu+ cells, while the second culture condition(minimal medium with leucine added) allows growth of all cells.The results of the experiment are as follows: Culture Condition Dilution ColoniesMinimal medium 10-1 18Minimal medium + leucine 10-7 6What is the rate of mutation at the locus associated with leucinebiosynthesis?
If deoxyribonucleotides that lack the 3’-OH groups are added during the replication process, what do you expect will occur? Describe what happens when a nonsense mutation is introduced into the gene encoding transposase within a transposon. A pure culture of an unknown bacterium was streaked onto plates of a variety of media. You notice that the colony morphology is strikingly different on plates of minimal media with glucose compared to that seen on trypticase soy agar plates. How can you explain these differences in colony morphology?
You examine DNA replication in an E. coli mutant, which has a partially defective DNA polymerase. In vitro experiments using the mutant DNA polymerase gives an error rate of 10-3, as compared to the expected error rate of 10-6. Which of the following activities is the mutant polymerase likely to be missing, as compared to the normal polymerase? Explain your answer.
Ultraviolet light can cause covalent linkages between consecutive pyrimidine bases in DNA (up to 100 per second in a single cell in sunlight!). These bulky lesions (i.e. cyclobutane pyrimidine dimers and 6-4 photoproducts), which inhibit DNA and RNA polymerases, are mostly reversed by CPD photolyase when light >300 nm is available to power the reaction. In the dark, however, which DNA repair system is best able to correct these errors? a) non-homologous end-joining b) mismatch repairc) nucleotide-excision repaird) base-excision repair e) homology-directed repair
Imagine a bacterial cell with a mutation that renders helicase completely nonfunctional (note that this would be a lethal mutation). What, precisely, would go wrong with replication in this cell? Please describe what goes wrong, as well as all downstream effects.
Many of the gene products involved in DNA synthesis wereinitially defined by studying mutant E. coli strains that could notsynthesize DNA. Question: The dnaE gene encodes the a subunit of DNA polymeraseIII. What effect is expected from a mutation in this gene?How could the mutant strain be maintained?
Why is DNA replication is considered a semi-discontinuous process? Explain in detail.
The experiment below is from a seminal set of experiments in the 1960s that illustrated the role of various repair pathways for DNA damage caused by UV radiation. In this experiment, the scientists isolated E coli strains that are mutant in the Rec A gene, the UvrA gene or both. They then irradiated cultures of each strain with increasing doses of UV light and measured the effect on cell viability. Answer the following questions about this data. A. Which DNA repair pathway and repair activity is inhibited by the Rec A mutant? B. Which DNA repair pathway and repair function is inhibited by UvrA mutant? C. Why is the UvrA/RecA double mutant so much more senitive to UV light than either mutant alone?
The anti-viral drug Acyclovir is a nucleotide analog that is lacking the 3’ OH group which is required to form a 3’→5’ phosphodiester bond. This drug is ineffective against DNA polymerases with proofreading abilities, which is why human DNA polymerases are not targeted. Acyclovir can be used to treatsevere cases of Epstein-Barr viral (EBV) infection, but has little to no effect under non-severe infections. Based on this information, EBV will use ________ DNA polymerase during severe infections and __________ DNA polymerase during non-severe infections. Human; Human EBV; Human EBV; EBV Human; EBV
Some antibiotic drugs fight infection by interfering with DNA replication, transcription, or translation in bacteria. Indicate whether each of the following antibiotic drug effects is on replication, transcription, or translation. HINT Each answer (replication, transcription, and translation) is used only once for the following: a. Rifampin binds to bacterial RNA polymerase. b. Streptomycin binds bacterial ribosomes, disabling them. c. Quinolone blocks an enzyme that prevents bacterial DNA from unwinding.
Suppose that 22% of the nucleotides of a DNA molecule are deoxyadenosine and during replication the relative amounts of available deoxynucleoside triphosphates are 22% dATP, 22% dCTP, 28% dGTP, and 28% dTTP. What deoxynucleoside triphosphate is limiting to the replication? Explain.
Below is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA CTAAAGCTTCGGGCATTATCG 3' GATTTCGAAGCCCGTAATAGC TATCGACS Consider the following primer which binds to the DNA replication bubble on the diagram above: 5'-GCUAUCG-3' Identify the DNA sequence to which this primer would bind and the orientation. If the replication fork moves to the right, will the primer be used to create the leading strand of replication or the lagging strand? Explain your answer b. If the replication fork moves to the left, will the primer be used to create the leading strand of replication or a. the lagging strand? Explain your answer. What would the next five nucleotides added to the primer by DNA polymerase? С.