A biochemist isolates, purifies, and combines in a test tubea variety of molecules needed for DNA replication. Whenshe adds some DNA to the mixture, replication occurs, buteach DNA molecule consists of a normal strand paired withnumerous segments of DNA a few hundred nucleotides long.What has she probably left out of the mixture?(A) DNA polymerase(B) DNA ligase(C) Okazaki fragments(D) primase

Q: Indicate whether each of the following statements is true or false. If a statement is false, explain…

A:

Q: DNA molecules with compatible sticky ends can be joined together by Select an answer and submit. For…

A: dna is the genetic material . it is a polymer of nucleotides , which are formed by nitrogen base ,…

Q: In the Meselson–Stahl experiment thatestablished the semiconservative nature of DNA replication,the…

A: Replication follows the semiconservative mode, which was proved by the experiment conducted by…

Q: A DNA strand has the following sequence:      5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′In which…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Separates DNA strands to expand the replication bubble. , DNA polymerase . Uses template strand to…

A: i)- Separates DNA strands to expand the replication bubble-Helicase ii)-Uses template strand to…

Q: An investigator obtains a bacterial temperature-sensitive mutation that affects a step in the…

A: Every DNA molecule is twisted into a ladder form known as a "double helix." The backbone of the DNA…

Q: Describe the early models of DNA replication that were investigated and explain how research by…

A: For DNA replication, three models were proposed: conservative, semi-conservative, and dispersive.…

Q: Cells have only one fundamental wayof replicating DNA but many differentways of repairing it. Are…

A: DNA is the genetic material present in the cells of living beings.

Q: Suppose that replication is initiated in a medium containing moderately radioactive tritiated…

A: Replication is the process of synthesis of DNA strands from the original strands where…

Q: Define the following words: replication fork, leading strand, lagging strand, Okazaki fragments,…

A: DNA replication is a biological process that occurs in all living organisms and is the basis for…

Q: Polymerases usually add only about 10 nucleotides toa DNA strand before dissociating. However,…

A: Nucleotides are the molecules composed of a sugar moiety, phosphate group, and a nitrogenous base.…

Q: The following diagrams represent DNA molecules that are undergoing replication. Draw in the strands…

A: Replication is bidirectional and originates at a single origin of replication ( Ori C ). Takes place…

Q: he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof…

A: Replication is the biological process in which a single copy of DNA is duplicated into two copies…

Q: Define the following terms related to DNA replication: origin of replication, helicase,…

A: Origin of replication: It is the site on the DNA from where DNA synthesis or replication is…

Q: Without the action of DNA ligase, cells would not be ableto complete their replication. What is the…

A: Answer is option c.) Binds DNA sequences together to generate acontinuous strand.

Q: (a) What is the function of helicase in DNA replication? (b) What is the function of DNA polymerase?…

A: DNA is called deoxyribonucleic acid. DNA act as genetic material in most organisms. DNA replication…

Q: 1) Fill in any replicated nucleic acids, using at least 2 Okazaki fragments where appropriate, Label…

A: DNA (Deoxyribonucleic acid) replication refers to the process that forms two identical DNA strands…

Q: Spontaneous oxidative deamination of guanine produces the base xanthine (see figure, which also…

A: As per the Watson-Crick model of the DNA double helix:DNA is made up of two strands of…

Q: Consider the following segment of DNA, which is part of a linear chromosome: LEFT…

A: DNA replication is the process by which the DNA is copied in the cell to make up more number of DNA…

Q: Which of the comparisons between DNA polymerase and RNA polymerase is false? -Both DNA polymerase…

A: DNA polymerase and RNA polymerase are enzymes involved in the synthesis of nucleic acids. DNA…

Q: On the right of the replication fork, which DNA strand (top or bottom) will be the template for…

A: Okazaki Fragments these are short stretches of DNA produced by a discontinuous synthesis of the…

Q: You have isolated what appears to be alien DNA. While studying its replication, you performed the…

A: DNA replication is the the process by which genome is duplicated. When the base sequence of each…

Q: A space probe returns from Mars where it has collected a new microorganism. It has double- stranded…

A: Introduction: DNA replication is the basis of biological inheritance in all living beings. The…

Q: a) If you isolated DNA from the ear and the tail of the same mouse, would you expect the DNA,…

A: The capacity to extract DNA is critical for researching the genetic causes of disease and developing…

Q: An investigator obtalns a bacterial temperature-sensitive mutation that affects a step in the…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: An Investigator obtains a bacterial temperature-sensitive mutation that affects a step in the…

A: Most of the replication enzymes are proteinaceous in nature. The structure of a protein is formed by…

Q: A bacterium synthesizes DNA at each replication fork at a rate of 1500 nucleotides per second. If…

A: The DNA replication is the process by which new DNA is produced from old DNA and it is usually…

Q: what happens to the intactness of DNA if extracted DNA fibers were placed in buffer of pH 3?

A: Extracted DNA is generally stored in neutral pH.

Q: A Scrhserved under a microscope, researchers observe that the DNA is able to be Sephe replicated.…

A:

Q: Semi-conservative replication means (a) when DNA is replicated it consists one old strand and one…

A: DNA REPLICATION  It is the formation of new DNA strands from the existing DNA. There can be 3 types…

Q: On paper, replicate the following segment of DNA:            5’ A T C G G C T A C G T T C A C 3’…

A: DNA replication is a complex process of producing copies of the entire chromosome using the…

Q: A friend asks for help understanding replication for the next biology test. (S)he draws a…

A: Replication of DNA takes place in 5' to 3' end direction. Template strand = 3' end to 5' end  , make…

Q: The following diagram represents a DNA molecule that is undergoing replication. Draw in the strands…

A: Chromosomes are carrier of deoxyribonucleic acid (DNA). DNA is the genetic material. Each species…

Q: Which would require a higher temperature to denature—a DNA strand composed primarily of A-T base…

A: DNA.  It is a long chain of polynucleotides. The DNA contain four bases  1. Adenine  2. Guanine 3.…

Q: Polymerases work is to add 10 nucleotides to a DNA strand before dissociating. During replication…

A: The compounds known as nucleotides are made up of a nitrogenous base, a phosphate group, and a sugar…

Q: The DNA polymerase involved in base excision repair isa) DNA polymerase αb) DNA polymerase βc) DNA…

A: DNA polymerase is an enzyme that synthesizes DNA molecules from deoxyribonucleotides, the building…

Q: electrophoresis separates fragments of DNA using: Movement of DNA fragments of different sizes at…

A: The correct answer is B) A sieving medium through which DNA molecules are moved by electrical…

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.