5'G-A-T-A-C-А-А-с-А-т-G-G-A-с-A-T-G-A-с-т3' What would be the first 3 bases in the 5' end of the complementary strand? Indicate the base sequence and the direction of synthesis of a 3-nucleotide RNA primer. Indicate the base sequence and the direction of synthesis of a 5-nucleotide Okazaki fragment (include a 3 nucleotide RNA primer, a total of 8 bases in the sequence). Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair and G-C base pair?

Q: Strand 1: C-G-T-A-T-C-T-C-A-T-A-G-C-TStrand 2 : A-A-A-G-A-T-A-T-C-A-C-C-C-AStrand 3 :…

A: The central dogma of molecular biology is that the DNA first undergoes replication to make a copy of…

Q: What is thee tRNA anticodon for the first 5’-ACGAUC-3’?

A:

Q: Hydroxylamine (NH2OH) converts cytosine to the compound shown below. With which base does this…

A: Transition mutation refers to a point mutation that changes a purine nucleotide to another purine or…

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? I and…

A: In the 1950s, Erwin Chargaff, a biochemist, discovered that the nitrogenous bases (A, T, C, and G)…

Q: 5' AU Py U A AGGCC G. UGGC G C G GGG What modified nucleoside base is indicated by the arrow?…

A: The answer of the above question is : Pseudouracil (Ψ). Pseudouridine (psi- Ψ)is an isomer of the…

Q: A researcher used the Sanger method to sequence the DNA fragment shown. The red asterisk indicates a…

A: Sanger sequencing, also known as the chain termination method, is a technique used to determine the…

Q: Write the complementary strand for each of the following strands of DNA. Part 1 of 4 5'-TTCGAAAA-3'…

A: Important information:DNA consists of two complementary strands that run in opposite directions…

Q: 14.11) Fill in the missing one-letter abbreviations for the organic bases in the image below to show…

A: DNA stands for Deoxyribonucleic Acid. It is a molecule that contains the genetic instructions used…

Q: Molnupiravir causes widespread mutations as SARS-CoV-2 replicates its genome because in an RNA…

A: Mutations are sudden changes in the genetic material which can be either DNA or RNA.Molnupiravir is…

Q: O 3'-GTA-CAG-CCG-CGT-5' ) 5'-CAC-GUC-GGC-GCA-3' 3'-CAT-GTC-GGC-GCA-5"

A: His-Val-Gly-Ala His= CAC Val=GUC Gly=GGC Ala=GCA   these amino acids get coded by other codes too,…

Q: What is the complete base composition of a double-stranded eukaryotic DNA that contains 22% guanine?…

A: Chromosomes in a eukaryotic cell are composed of DNA and protein. DNA in eukaryotes is double…

Q: The coding strand has the following sequence. Please answer the questions below with regard to this…

A: The coding strands run in 3' to 5' direction and has codons it is transcribed as it is in the mRNA…

Q: 5'AGGCTCCAGG 3' Which complementary RNA strand can be made from this sequence? Select one: O a. 5'…

A: formation of m RNA from DNA is called transcription. RNA polymerase synthesizes m RNA by adding…

Q: .1. Give the complete complimentary bases of the parent DNA strand according to Chargaff's rule and…

A: The Chargaff’s rule state that the quality of the nitrogenous base pairs in the DNA is always equal.…

Q: Draw the following trinucleotide: pGAU

A: A nucleotide is composed of a nitrogen base, a pentose sugar and a phosphate group. A trinucleotide…

Q: How many different sequences are possible for a tripeptide containing one molecule of valine, one…

A: Valine is a nonpolar amino acid with aliphatic R groups, represented by V. Glycine is the simplest…

Q: 5’ - A T G    G C C    C A A    C T G    A C C - 3’ a. How many nucleotides are listed here b. How…

A: Transcription is the process by which the genetic information encoded in DNA is copied into a…

Q: To maintain uniform diameter of the DNA double helix, only purines base with each other via two…

A: DNA is the fundamental structure that carries all the information of a living thing. In most cases,…

Q: structure of its covalent adduct to DNA

A: Chlorambucil is a monocarboxylic acid that is butanoic acid replaced at the 4th position by a…

Q: Sequencing of the following fragment of single-stranded DNA needs to be undertaken using the Sanger…

A: Sanger sequencing, also referred to as the “chain termination method”, may be a method for…

Q: SARS-CoV-2 virus infection. Your advisor gives you the double-stranded DNA sequence encoding Peptide…

A: Transcription is the process of formation of a sequence of RNA using DNA as a template. Translation…

Q: Given a primer sequence 3’- CTGGGAAACATTCTGGAT - 5’, compute for the melting temperature of this…

A: Melting temperature of primer can be defined as a temperature at which one half of the DNA double…

Q: Which of the following sequences is less favorable to find in a folded beta? Select one:…

A: Two types of secondary structures are abundant in protein: alpha helix and beta sheets.  The alpha…

Q: Why are proteases added while isolating the DNA?

A: Proteases are a group of enzymes which break the proteins into peptides and amino acids.

Q: A 918,980 Å long double stranded DNA molecule is the B-conformation. If the DNA has has alternating…

A: DNA (Deoxyribonucleic acid) has two strands. These strands bond with each other hydrogen bonds. The…

Q: EcoRI --- 5' G - AATTC 3'       5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3'     3'…

A: The DNA is formed of several repeating units of monomers called nucleotides. The adjacent…

Q: 5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgte-5" The diagram above shows an RNA primer…

A: Given -  RNA primer :   B   5'-ccuaaucg-3"    C   Template strand :    A…

Q: 5’ TAAGCGTAACCCGCTAA   CGTATGCGAAC   GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT   GCATACGCTTG…

A: The DNA is a double stranded molecule which are paired along with a complimentary strand. The above…

Q: A-DNA has a helix diameter of 25.5 Angstrom, a pitch per turn of 25.3 Angstrom, and a rise per base…

A: The A-DNA, B-DNA, and Z-DNA are the commonly occurring structural conformations of DNA. The most…

Q: Draw the following strands of DNA 5’ C-A-T 3’ as well as the complementary base pairing strand…

A: Two strands of DNA twist around one another to form a double helix DNA and both are in anti-parallel…

Q: 5'- ATG CTG TTT GTA CGG GÁC TAA-3' a) Write out the DNA template side for the DNA coding side above?…

A: Introduction The term template strand refers to the sequence of DNA that is copied during the…

Q: 48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of…

A: The antisense DNA sequence is - 5' GGACCCTAT 3' The single nucleotide deletion can occur at any…

Q: Which of the following statements about DNA and RNA is CORRECT? Select an answer and submit. For…

A: Nucleic acids are polymeric molecules with a long chain. The monomer or repeating unit is known as a…

Q: 1. Give the complete complimentary bases of the parent DNA strand according to Chargaff's rule and…

A: DNA is a deoxyribonucleic acid. It is the double helical molecule which carries genetic information…

Q: polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…

A: Wild type sequence : Met Ser Pro Arg Leu Glu Gly    Mutant 1: Met Ser Pro   After pro, the peptide…

Q: (i) Indicate by drawing where the RNA of Telomerase binds to the telomeric region. W, X, Y, and Z…

A:

Q: The adenine derivative hypoxanthine can base-pair with adenine. Draw the structure of this base…

A: A Wobble base pair is the pairing between two nucleotides in RNA molecules that does not follow…

Q: In which direction does DNA polymerase synthesize the lagging strand?

A: Lagging Strand:  A single DNA strand known as the lagging strand is reproduced in the 5′ - 3′…

Q: I have a question I'm not sure about here it is...... If a short sequence of DNA is…

A: The Correct option is 2.DNA (deoxyribonucleic acid) is a double stranded molecule in which the two…

Q: Choose all of the statements that correctly describe the base pairs drawn below. A C -O -H-N B D…

A: The four bases that make up DNA are adenine (A), cytosine (C), guanine (G), and thymine (T), while…

Q: Show the expected labeled cleavage products if the following DNA segment were subjected to each of…

A: D.N.A. Cleavage ---  A cleavage of single - stranded DNA oligonucleotides in the presence of ionic…

Q: I need help because i don't get it. Can you help me to explain to me, please?

A: DNA It refers to the molecule that constitutes genetic information that is passed from generation ot…

Q: If the code were a sextuplet (containing of six nucleotides), would the reading frame be restored by…

A: A frameshift mutation is induced by adding or deleting several nucleotides in a DNA sequence that is…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.