3. Identify if the following is a pyrimidine/purine nucleotide or a pyrimidine/purine nucleoside and write whether the sugar moiety is a ribose or deoxyribose. NH2 NH2 но OH но. A. В. ÓH ОН ОН OH NH HN of но. осн CH C. D. OH H он он Complete the table below: 4. RNA DNA Strand Sugar residue Nitrogenous bases Main Function

Q: a) Which of the three CD spectra matches the Ramachandran plotted protein. 25 25 25 I. II. III. 20…

A: Ramachandran's plot helped for evaluating the accuracy of predicted protein shape. The Ramachandran…

Q: 3. Use the 15 molecules illustrated below to answer the following question. Nucleotides consist of a…

A: The basic structure of nucleotides is shown below:

Q: Identify if the following is a pyrimidine/purine nucleotide or a pyrimidine/purine nucleoside and…

A: The nucleic acids are known as polynucleotides. Monomeric units of nucleic acids are called…

Q: 5. In a portion of polypeptide shown below, which bond is described by o O0 0? А. 1 В. 2 С.3 D. 4 E.…

A: A polypeptide chain is a linear chain of many amino acids.

Q: 2. Draw the structural formula of the amino acid asparagine that predominates in solution at each of…

A: Asparagine is a polar amino acid. It contains one amide group in its side chain which is not…

Q: Indicate which of the following descriptions does not apply to the biochemical depicted here: O=d-0…

A: The DNA is a double-stranded molecule. Each strand is made-up of a sequence of four bases A, T, G,…

Q: The phosphorylated 5-carbon monosaccharide required for nucleotide synthesis is: ,a. Ribulose 1,…

A: Nucleotide synthesis takes place in the cytosol of the liver. The first committed step for…

Q: 3. Below is the structure of a nucleotide triphosphate. of of of O ATP R-O- R-O O R-O O O O O +|| O…

A: Nucleotides are organic molecules that form the basic building blocks of nucleic acids (DNA and…

Q: 1. Encircle the chiral carbons in the given structures. 2. Identify which structures are D and L…

A: Chiral carbon is an asymmetric carbon atom that consists of different types of atoms attached to a…

Q: 3. Use the 15 molecules illustrated below to answer the following question. Nucleotides consist of a…

A: DNA and RNA are the nucleic acids used as genetic carriers to transfer information from one…

Q: 7. Predict the bases that will pair with the following bases to form the complementary messenger…

A: There are basically 4 types of nitrogenous bases ATGC and in RNA thymine is replaced with Uracil.

Q: Examine the structure shown below and answer the following questions: 1. Name the structure (be as…

A: Nucleic acids or nucleotides are usually consists of mainly nitrogen bases, sugar, and phosphate…

Q: 7. The diagram below represents a portion of a deoxyribonucleic acid. 10 sbri odt Which sequence of…

A: DNA is a polynucleotide chain, where it contains a deoxyribose suger, nitrogen base and a phosphate.…

Q: C Co

A: Introduction Nucleotides form the basic structure of  DNA and RNA. DNA( deoxyribonucleic acid) and…

Q: Directions: Write the letter of the correct answer to complete the paragraph. Use a separate sheet…

A: DNA is the genetic material in living organisms that is present within the nucleus, chloroplast and…

Q: 1) What is wrong with the nucleoside shown below? Focus on the sugar portion. What sugar should be…

A: We have two types of nucleic acids namely:DNA or Deoxyribonucleic acid andRNA or Ribonucleic acid…

Q: The glycosidic linkage in nucleoside forms from the C-1' carbon of a. N-6 nitrogen of pyrimidines…

A: A glycosidic bond or glycosidic linkage is a type of covalent bond that joins a carbohydrate…

Q: heoretically, if the following nucleotides were to pair during RNA synthesis, how many hydrogen…

A: RNA synthesis, or transcription, is that the method of transcribing polymer nucleotide sequence info…

Q: 9. For the DNA segment with nucleotide sequence 5' TATCGC 3', how many hydrogen bonds in total hold…

A: Enantiomers are chiral molecules that are mirror images of one another. The molecules are…

Q: MATCH a structure from the list helow to each ofthe following terms. Place the letter of the…

A: Amino acids are the biomolecules that are used to form proteins by joining the amino acids with the…

Q: The bisulfite sequencing is different from regular sanger sequencing of nucleotides because…

A: The Sanger sequencing is also known as the chain termination method, it is a method used to…

Q: 1. Look at the following diagram of a nucleotide, below, and circle and label all three components:…

A: A nucleotide is composed of 3 components;A pentose sugarA nitrogenous baseOne or more phosphate…

Q: Which statement is FALSE regarding when a pyrimidire base is incorporated into a deoxynucleoside?…

A: DNA ( deoxyribonucleic acid) is a type of nucleic acid.  Nucleic acids are present inside the…

Q: ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser…

A: Complementary strand of RNA is formed by complementary base pairing that occurs between adenine and…

Q: 2. Given the data in the table, calculate the pl for the amino acid tyrosine. Amino Acid Glycine…

A: The proteins are biological macromolecules that are composed f amino acids connected via peptide…

Q: Please define each one be specific which one goes in a,b,c,d,e,f

A: The above diagram shows DNA replication in eukaryote. DNA replication occurs in three steps -…

Q: AŅH2 B H. E но-р-о N. o+c D OH OH

A: Nucleotides are referred to as the building blocks of nucleic acids. Each nucleotide is made up of a…

Q: The figure below shows the structures of the blood group antigens O, A and B.List all nucleotide…

A: The ABO blood group is an example of multiple alleles in which total three alleles are responsible…

Q: 7. Aspartic acid has a side chain bearing a carboxylic acid group; its pK, is 4. The a-amino and…

A: Ans. 7) The pKa values tells us about the strength of an acid.

Q: nbonucleotide in automated RNA synthesis. Point to the functional groups

A: In automated RNA synthesis, a ribo nucleotide is used. When we look at epinephrine signalling, we…

Q: 3. Give the different hydrolytic products of : a. DNA b. RNA

A: DNA and RNA are made up of long chains of nucleotides. Sugar molecule, ribose in RNA, and…

Q: 5. How would you classify B and c? What are they used for? Are A and D diastereomers? Are A and D…

A: Carbohydrates are polyhydroxy aldehydes or ketones. Monosaccharides are simplest carbohydrates:…

Q: 8. Provide the structure of guanine, a heterocyclic base found in DNA. 9. Provide the structure of…

A: Nucleic acids are biomolecules composed of nucleotides. Nucleotides are composed of a pentose sugar…

Q: 9. What technique is used to determine the amino acid sequence of a purified protein? 10. Indicate…

A: Protein sequencing is a method for determining a protein's amino acid sequence, as well as its shape…

Q: Draw and name the covalent linkage between two deoxynucleotides. Indicate both the 5’ and 3’ end.…

A: Deoxyribonucleotides are the smallest units present in DNA. DNA is also known as deoxyribonucleic…

Q: 6. a.) Which part (sugar, phosphate, or nitrogenous base) of the four types of nucleotides differ?…

A: Nucleosides contain only sugar and a base whereas Nucleotides contain sugar, base, and a phosphate…

Q: 1.a. Draw the synthesis of nucleotides. b. Draw the degradation of nucleotides.

A: Nucleotides serve as the basic building blocks of nucleic acids.. They comprise of a sugar molecule…

Q: 1. Name the first complementary base from the 3' direction. 2. Name the fourth nucleotide from the…

A: The nucleic acids are composed of nucleotides that is the combination of sugar, phosphate and…

Q: The bases represented by X are... Select one: OA. Uracil O B. Guanine OC. Adenine D. Cytosine X

A: Nucleobases, often known as nitrogenous bases or just bases, are biological substances having…

Q: C A T A C G C G T A с G

A: The given figure shows the process of DNA replication. DNA replication refers to the process of…

Q: Which of the following descriptions best describes the composition of nucleotides?   Group of…

A: Nucleic acids are macromolecules which are formed by the polymerization of multiple units called…

Q: we focus on DNA nucleotides, they have one phosphate group. a. What kind of sugar do they have? b.…

A: Nucleic acids ( DNA and RNA ) are made up of nucleotides. The DNA( Deoxyribonucleic acid) is made up…