1.What would you predict would happen if you added Anti-A serum to this type of blood? 2. What would you predict would happen if you added Anti-B serum to this type of blood?3. Why is the genotype that codes for this blood type considered “codominant”?Please answer all of them now and do it
Q: You have an adult patient who is exhibiting persistent and severe infections caused by opportunistic…
A: Without a doubt! To better understand the diagnostic workup and treatment options available to a…
Q: I have a vial of F2 offspring resulting from a two-generation cross between true-breeding wildtype…
A: b) Pink body color females:Expected number = Total number of flies * Probability of being pink= 120…
Q: Essay about Papua Pew Guineas unique biodiversity and rich ecosystems
A: The objective of this question is to provide an in-depth understanding of the unique biodiversity…
Q: der these chemical species by increasing pH of an 0.1 M aqueous solution of each. That is, imagine…
A: Step 1: Step 2: I have given detailed step by step solution approach to solve this problem go…
Q: cardiac output drops, then A and B • A and C Blood flow must decrease Blood flow must increase The…
A: The objective of the question is to understand the physiological changes that occur when cardiac…
Q: Replication Methods and Central Dogma1. Information about replication2. What happens at each step
A: DNA replication is a crucial process in biology, essential for the accurate transmission of genetic…
Q: Proto-oncogenes can change into oncogenes that cause cancer. Which of the following best explains…
A: Cancer is caused by abnormal cell growth causing the formation of tumors. Tumor is a mass of cells…
Q: The Belgian anatomist and physician Andreas Vesalius, in his textbook entitled De Humani Corporis…
A: Andreas Vesalius disagreed with Galen that right/left ventricles blood could flow directly. Vesalius…
Q: Whisker number in a new breed of mouse is controlled by 2 genes. The line with no contributing…
A: When crossing an AaBb mouse with an AaBB mouse, the offspring can have four different genotypes:…
Q: When Mendel crossed yellow-seeded and green-seeded pea plants, all the offspring were yellow-seeded.…
A: The allele for yellow seeds should be written in uppercase letters, while the one for green seeds…
Q: Learning Task # 2. Punnett Square a. Given the cross AaBb X AaBb, construct a Punnett square and…
A: AABB (homozygous dominant for both traits): 1 part out of 16 total partsAABb (homozygous dominant…
Q: Please answer both thank you!
A: 11)Answer:Centrifuges are workhorses in blood analysis, utilizing the principles of circular motion…
Q: What is the significance of the complementarity of the two strands of DNA? It prevents mutations…
A: The question is asking about the importance of the complementarity of the two strands of DNA.…
Q: https://journals.lww.com/acsm-essr/Pages/issuelist.aspx You will need to access the journal website…
A: A randomized experiment was conducted to investigate the effects of early physical exercise therapy…
Q: answer both 5 and g i also got an answer for 5 which is…
A: The genetic code is the system by which the nucleotide sequence of DNA is translated into the amino…
Q: Show the cross between a pure breeding dominant tall pea plant and a short plant in a punnet square
A: Pure-breeding means a homozygous genotype i.e. both the alleles present in the genotype of an…
Q: Students filled three identical flasks with water and placed elodea, a type of aquatic plant, in…
A: Explanation:The presence of dissolved oxygen in water is closely related to the process of…
Q: The cytoplasmic granule of RNA and protein that reads the message in mRNA is a/an____________ .
A: In cells, different parts have specific jobs in making and controlling proteins. One important part…
Q: You have cultured cells in 10mL of medium. You take a sample and view it under a hemocytometer. The…
A: The objective of this question is to calculate the total number of cells in the culture medium using…
Q: 18
A: DNA sequence 5'ACCTGTGCAATATACGGCCAT3'3'TGGACACGTTATATGCCGGTA5'mRNA5' ACCUGUGCAAUAUACGGCCAU 3'Amino…
Q: Zollinger-Ellison syndrome is a peptic ulcer disease characterized by overproduction of gastric…
A: Approach to solving the Question(s):To answer the question about the two types of stomach cells…
Q: How does light pollution negatively impact sea turtles / the aspect of human health? Explain.
A: Approach to solving the question:Light pollution disrupts a vital navigation system for sea turtle…
Q: Impedance technology is based on the fact that blood cells increase electrical conductivity in…
A: The objective of the question is to determine the validity of the statement: 'Impedance technology…
Q: Mark the following statements as true or false. If a statement is false, correct it to make a true…
A: In cellular metabolism, a series of chemical reactions happen, numerous of which include the…
Q: Match each of the following descriptions to the type of regulatory RNA affecting a "target" gene…
A: Of course! Let's break down each match:This regulatory RNA may increase transcription of the target…
Q: Do the cells migrate to new locations during development and form selective adhesions with other…
A: Amid the early stages of development, cells alter a lot. They not only do diverse things, but also…
Q: How would most biologists and anthropologists explain the reasons behind why primates do specific…
A: Primate behavior is generally understood by scientists and anthropologists to be the consequence of…
Q: When sterile compounding, which of the following are considered critical points (Select all that…
A: In sterile compounding, maintaining sterility is paramount to ensure the safety and efficacy of the…
Q: Based on this tree, fill in the table below it, using 1 to indicate the presence of a trait and 0 to…
A: In the table provided, each row represents a trait (A, B, C, D, E), and each column represents a…
Q: a diagram that shows evolutionary connections between clades is called a_______ . a. karyotype c.…
A: Understanding the links and divergences between different species or groups over time is fundamental…
Q: In most parts of the world, commercial potato crops are produced asexually by planting tubers.…
A: Growing potatoes mainly includes asexual generation through planting tubers. This strategy is…
Q: What does it mean that an allele increases an organism's fitness? Choose one of the following: it…
A: Alleles: These are different forms of a gene. Organisms inherit alleles from their parents, and…
Q: Which of the three phylogenetic trees of the Drosophila species is different from the other two? a.…
A: Approach to solving the question:Carefully observe the 3 trees and find which is different Detailed…
Q: A bacterial culture is initially composed of 100 cells. After 1 hour the number of bacteria is 1.5…
A:
Q: Stark law (Physician Self-Referral Law) Summarize the law or regulation above. Describe the entity…
A: Here's a detailed breakdown of how I approached solving the questions regarding Stark Law, including…
Q: Which of the following metabolic tests would only be performed on Gram-positive bacillus? VP TSIA…
A: The objective of the question is to identify which among the given metabolic tests is specifically…
Q: Out of the three, what would be an example of evolution? A population of green beetles changes over…
A: The objective of the question is to identify which of the given scenarios is an example of…
Q: Rouleaux is characteristic of which clinical condition? Question 4 options:…
A: The objective of the question is to identify the clinical condition that is characterized by the…
Q: A wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the…
A: To explain--M1: Met-Ser-Ser-Arg-Leu-Glu-GlyThis mutation involves the substitution of Pro with Ser.…
Q: consequences of not managing water
A: Key references:…
Q: Why might it be advisable for an Rh–woman who has had an abortion, miscarriage, or an ectopic…
A: The Rh factor is something on red blood cells. A few individuals have it (called Rh+) and a few…
Q: A family with a history of a genetic disorder were analyzed with a dot blot using a probe for both…
A:
Q: Which of the following mutations cannot be inherited by a person's biological children? A mutation…
A: The objective of the question is to identify which type of mutation cannot be passed on to a…
Q: If a DNA strand has the sequence AGCATC, what will be the sequence on the complementary strand?
A: Sure, let's break it down step by step:1. The given DNA sequence is AGCATC.2. According to the base…
Q: -Centromere D D Ø ☹ A B ℗ ℗ D E C
A: The objective of the question is to understand the chromosomal condition during the prometaphase…
Q: You have cultured cells in 10mL of medium. You take a sample and view it under a hemocytometer. The…
A: Culture medium is generally referred to as "medium". It is a nutrient-rich solution used to support…
Q: A original pedigree: 8 alleles 3 78 13 1 2 12 34 34 5 6 23 56 7 8 9 10 11 12 37 17 26 25 36 35 Using…
A: We search for situations in which a child has a combination of alleles that could not have been…
Q: hat are orthologs ?
A: Orthologs are genes in particular species that separated from a common predecessor gene due to…
Q: 16) Bacterial DNA replication is said to be: a) Linear b) curvilinear c) circular d) exponential e)…
A: 16) Bacterial DNA replication is said to be circular. This is because bacterial DNA is organized in…
Q: Can u give me the correct answer
A: Solution: (information required was not provided. One possible food web is provided in the image…
1.What would you predict would happen if you added Anti-A serum to this type of blood?
2. What would you predict would happen if you added Anti-B serum to this type of blood?
3. Why is the genotype that codes for this blood type considered “codominant”?
Please answer all of them now and do it
Step by step
Solved in 2 steps
- Figure 13.4 Which of the following statements is true? Recombination of the body color and red/ cinnabar eye alleles will occur more frequently than recombination of the alleles for wing length and aristae length. Recombination of the body color and aristae length alleles will occur more frequently than recombination of red/brown eye alleles and the aristae length alleles. Recombination of the gray/black body color and long/short aristae alleles will not occur. Recombination of the red/brown eye and long/short aristae alleles will occur more frequently than recombination of the alleles for wing length and body color.Should he go ahead and enroll on the chance that he would receive the DNA vaccine and that it would be more effective than chemotherapy? Bruce and his parents moved to a semi-tropical region of the United States when he was about 3 years old. He loved to be outside year-round and swim, surf, snorkel, and play baseball. Bruce was fair-skinned, and in his childhood years, was sunburned quite often. In his teen years, he began using sunscreens, and although he never tanned very much, he did not have the painful sunburns of his younger years. After graduation from the local community college, Bruce wanted an outdoor job and was hired at a dive shop. He took people out to one of the local reefs to snorkel and scuba dive. He didnt give a second thought to sun exposure because he used sunscreen. His employer did not provide health insurance, so Bruce did not go for annual checkups, and tried to stay in good health. In his late 20s, Bruce was injured trying to keep a tourist from getting caught between the dive boat and the dock. He went to an internist, who treated his injury and told Bruce he was going to give him a complete physical exam. During the exam, the internist noticed a discolored patch of skin on Bruces back. She told him that she suspected Bruce had skin cancer and referred him to a dermatologist, who biopsied the patch. At a follow-up visit, Bruce was told that he had melanoma, a deadly form of skin cancer. Further testing revealed that the melanoma had spread to his liver and his lungs. The dermatologist explained that treatment options at this stage are limited. The drugs available for chemotherapy have only temporary effects, and surgery is not effective for melanoma at this stage. The dermatologist recommended that Bruce consider entering a clinical trial that was testing a DNA vaccine for melanoma treatment. These vaccines deliver DNA encoding a gene expressed by the cancer cells to the immune system. This primes the immune system to respond by producing large quantities of antibodies that destroy melanoma cells wherever they occur in the body. A clinical trial using one such DNA vaccine was being conducted at a nearby medical center, and Bruce decided to participate. At the study clinic, Bruce learned that he would be in a Phase Ill trial, comparing the DNA vaccine against the standard treatment, which is chemotherapy, and that he would be randomly assigned to receive either the DNA vaccine or the chemotherapy. He was disappointed to learn this. He thought he would be receiving the DNA vaccine.The ABO blood system has been used to settle cases of disputed paternity. Suppose, as a geneticist, you must testify during a case in which the mother has type A blood, the child has type O blood, and the alleged father has type B blood. How would you respond to the following statements? a. Mans attorney: The mother has type A blood, so the childs type O blood must have come from the father. Because my client has type B blood, he could not be the father. b. Mothers attorney: Further tests prove this man is heterozygous, so he must be the father.
- A couple was referred for genetic counseling because they wanted to know the chances of having a child with dwarfism. Both the man and the woman had achondroplasia (MIM 100800), the most common form of short-limbed dwarfism. The couple knew that this condition is inherited as an autosomal dominant trait, but they were unsure what kind of physical manifestations a child would have if it inherited both mutant alleles. They were each heterozygous for the FGFR3 (MIM 134934) allele that causes achondroplasia. Normally, the protein encoded by this gene interacts with growth factors outside the cell and receives signals that control growth and development. In achrodroplasia, a mutation alters the activity of the receptor, resulting in a characteristic form of dwarfism. Because both the normal and mutant forms of the FGFR3 protein act before birth, no treatment for achrondroplasia is available. The parents each carry one normal allele and one mutant allele of FGRF3, and they wanted information on their chances of having a homozygous child. The counsellor briefly reviewed the phenotypic features of individuals with achondroplasia. These include facial features (large head with prominent forehead; small, flat nasal bridge; and prominent jaw), very short stature, and shortening of the arms and legs. Physical examination and skeletal X-ray films are used to diagnose this condition. Final adult height is approximately 4 feet. Because achondroplasia is an autosomal dominant condition, a heterozygote has a 1-in-2, or 50%, chance of passing this trait to his or her offspring. However, about 75% of those with achondroplasia have parents of average size who do not carry the mutant allele. In these cases, achondroplasia is due to a new mutation. In the couple being counseled, each individual is heterozygous, and they are at risk for having a homozygous child with two copies of the mutated gene. Infants with homozygous achondroplasia are either stillborn or die shortly after birth. The counselor recommended prenatal diagnosis via ultrasounds at various stages of development. In addition, a DNA test is available to detect the homozygous condition prenatally. What is the chance that this couple will have a child with two copies of the dominant mutant gene? What is the chance that the child will have normal height?A couple was referred for genetic counseling because they wanted to know the chances of having a child with dwarfism. Both the man and the woman had achondroplasia (MIM 100800), the most common form of short-limbed dwarfism. The couple knew that this condition is inherited as an autosomal dominant trait, but they were unsure what kind of physical manifestations a child would have if it inherited both mutant alleles. They were each heterozygous for the FGFR3 (MIM 134934) allele that causes achondroplasia. Normally, the protein encoded by this gene interacts with growth factors outside the cell and receives signals that control growth and development. In achrodroplasia, a mutation alters the activity of the receptor, resulting in a characteristic form of dwarfism. Because both the normal and mutant forms of the FGFR3 protein act before birth, no treatment for achrondroplasia is available. The parents each carry one normal allele and one mutant allele of FGRF3, and they wanted information on their chances of having a homozygous child. The counsellor briefly reviewed the phenotypic features of individuals with achondroplasia. These include facial features (large head with prominent forehead; small, flat nasal bridge; and prominent jaw), very short stature, and shortening of the arms and legs. Physical examination and skeletal X-ray films are used to diagnose this condition. Final adult height is approximately 4 feet. Because achondroplasia is an autosomal dominant condition, a heterozygote has a 1-in-2, or 50%, chance of passing this trait to his or her offspring. However, about 75% of those with achondroplasia have parents of average size who do not carry the mutant allele. In these cases, achondroplasia is due to a new mutation. In the couple being counseled, each individual is heterozygous, and they are at risk for having a homozygous child with two copies of the mutated gene. Infants with homozygous achondroplasia are either stillborn or die shortly after birth. The counselor recommended prenatal diagnosis via ultrasounds at various stages of development. In addition, a DNA test is available to detect the homozygous condition prenatally. Should the parents be concerned about the heterozygous condition as well as the homozygous mutant condition?A couple was referred for genetic counseling because they wanted to know the chances of having a child with dwarfism. Both the man and the woman had achondroplasia (MIM 100800), the most common form of short-limbed dwarfism. The couple knew that this condition is inherited as an autosomal dominant trait, but they were unsure what kind of physical manifestations a child would have if it inherited both mutant alleles. They were each heterozygous for the FGFR3 (MIM 134934) allele that causes achondroplasia. Normally, the protein encoded by this gene interacts with growth factors outside the cell and receives signals that control growth and development. In achrodroplasia, a mutation alters the activity of the receptor, resulting in a characteristic form of dwarfism. Because both the normal and mutant forms of the FGFR3 protein act before birth, no treatment for achrondroplasia is available. The parents each carry one normal allele and one mutant allele of FGRF3, and they wanted information on their chances of having a homozygous child. The counsellor briefly reviewed the phenotypic features of individuals with achondroplasia. These include facial features (large head with prominent forehead; small, flat nasal bridge; and prominent jaw), very short stature, and shortening of the arms and legs. Physical examination and skeletal X-ray films are used to diagnose this condition. Final adult height is approximately 4 feet. Because achondroplasia is an autosomal dominant condition, a heterozygote has a 1-in-2, or 50%, chance of passing this trait to his or her offspring. However, about 75% of those with achondroplasia have parents of average size who do not carry the mutant allele. In these cases, achondroplasia is due to a new mutation. In the couple being counseled, each individual is heterozygous, and they are at risk for having a homozygous child with two copies of the mutated gene. Infants with homozygous achondroplasia are either stillborn or die shortly after birth. The counselor recommended prenatal diagnosis via ultrasounds at various stages of development. In addition, a DNA test is available to detect the homozygous condition prenatally. What if the couple wanted prenatal testing so that a normal fetus could be aborted?
- The genotype XXY corresponds to Klinefelter syndrome Turner syndrome Triplo-X Jacob syndromeIf your father were diagnosed with an inherited disease that develops around the age of 50, would you want to be tested to find out whether you would develop this disease? If so, when would you want to be tested? As a teenager or sometime in your 40s? If not, would you have children?Figure 12.6 What are the genotypes of the individuals labeled 1, 2, and 3?
- The gene controlling ABO blood type and the gene underlying nail-patella syndrome are said to show linkage. What does that mean in terms of their relative locations in the genome? What does it mean in terms of how the two traits are inherited with respect to each other?Achondroplasia is a rare dominant autosomal defect resulting in dwarfism. The unaffected brother of an individual with achondroplasia is seeking counsel on the likelihood of his being a carrier of the mutant allele. What is the probability that the unaffected client is carrying the achondroplasia allele?Zoe has cystic fibrosis. Which of the following is the most likely explanation? Zoe probably inherited one faulty allele from her father, who is a earner, and one normal allele from her mother. Zoe probably inherited one faulty allele from her mother, who must also have cystic fibrosis, and one normal allele from her father. Zoe must have inherited faulty alleles from both parents, both of whom must also have cystic fibrosis, Zoe must have inherited faulty alleles from both parents, both of whom are earners.
