1.11 Which post-translational modification prepares proteins for degradation? O Ubiquitinylation O Glycosylation O Phosphorylation O Oxidation
Q: Glycophospholipids, classification and role in the body. Give examples, draw a structure.
A: Glycophospholipids are biomolecules that play an important function in the regulation of cellular an...
Q: Over the last 50 years, the carbon dioxide abundance in the atmosphere has decreased, and the averag...
A: The answer of the following question is given below.
Q: Question 7 The uncoupling agent 2,4-dinitrophenol (DNP) has a pk, of about 7.2. Which of the followi...
A: Uncouplers are the compounds that interact with electron transport chain and inner mitochondrial mem...
Q: How many net ATP molecules are produced during the reactions of photosynthesis for each molecule of ...
A: The dark reaction or light independent reaction of photosynthesis reduces carbon dioxide to glucose....
Q: Mutarotation affects the reducing property of carbohydrates. True False
A: Mutarotation: It is a spontaneous change that takes place in the optical rotation of alpha and beta...
Q: Identify the principles of the lyophilization process and list down the precautions and limitations ...
A: Lyophilization is the process of freeze-drying also called cryodesiccation. It involves ...
Q: b. CH CH2 | H;Č CH3 - Polypeptide backbone H3C CH3 ! CH C=OH -CH2+S-S CH2– а. CH2 -CH2-CH2-CH2–CH2-N...
A: The structural organization of protein was classified into four different levels and they are primar...
Q: Proteoglycans are often made up of glycosaminoglycans (chondroitin sulfate, keratan sulfate, and der...
A: On the basis of composition, proteins can be either simple or conjugated. Conjugated proteins cons...
Q: threose-4 phosphate (a 4 carbon aldose) is fed into glycolysis after a decarboxylation reaction that...
A: Aldose is a monosaccharide and consists of carbon chain containing a carbonyl group on the endmost c...
Q: What is the "pucker" conformation of deoxyribose in the B-form structure of DNA? C2-endo ...
A: Sugar puckering :- geometry of ribose sugar have 5 endocyclic TIRTIONAL ANGLES.
Q: Proteins in their functional, folded conformation are called _____ proteins. Question 44 options: ...
A: Proteins are macromolecules that are polymers of structural units known as amino acids. Proteins inc...
Q: What type of regulation would be expected when anaerobic metabolism is occurring in the muscle? Sele...
A: Depending on the need of the body, the fate of intermediates of Glycolysis, gluconeogenesis, Citric ...
Q: Give one or two product of Milk and answer the following queston: look at the labels of the differen...
A: "Since you have posted a question with multiple sub-parts, we will solve first three sub parts for y...
Q: 3. What is the marker for the enzyme’s optimum condition?
A: The conditions under which an enzyme is most active are the optimum conditions(like pH,temperature)
Q: The membrane phospholipids phosphatidyl serine and phosphatidyl choline are named based on ...
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question s...
Q: 1. Why did some food sample do not have the significant color change with iodine test? 2. Explain t...
A: Iodine test is used to detect the presence of starch. It is done with Lugol's reagent, which is a mi...
Q: A chiral molecule is one that is not superposable on its mirror image, thus a chiral carbon is a car...
A: A chiral molecule has a chiral centre/ asymmetric carbon atom and it has a non-superposable mirror i...
Q: Is this the correct answer of R and T in the blanks or are they switched?
A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. These twen...
Q: What is the difference between polymerization and polycondensation reactions? Select one: a. There a...
A: Polycondensation is any condensation reaction that results in the production of a polymer from a mon...
Q: Why do you need to calculate for volume of media needed after computing the cells? If you are provid...
A: Hemocytometer is a cell number counting chamber device and was designed to count blood cells. The de...
Q: 5' C A G In the reaction shown, O a phosphoanhydride bond is broken and a phosphate ester bond is fo...
A: A phosphodiester bond occurs when two of the hydroxyl groups in phosphoric acid react with hydroxyl ...
Q: Given the electrophoresis profile of a Sanger sequencing result, what was the sequence of the origin...
A: Sanger sequencing method is also called as chain termination method. In this method dideoxy NTP is u...
Q: Seliwanoffs Test
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any ...
Q: Answer post lab question only. You can use this as your source : https://youtu.be/rKng5-ij6kQ
A: Glucose,Fructose- Reducing monosaccharide(as free hemiacetal group is present) Lactose - Reducing di...
Q: How many stereoisomers are possible in Aldopentoses? Select one: a. 6 O b. 8 с. 2 d. 4
A: Stereoisomers are molecules with the same chemical formula and bound atom sequence but different thr...
Q: Explain the role of L-tartrate in the determination of acid phosphatase .
A: Hello! Thank you for the questions. As you have posted multiple questions, I will be answering the f...
Q: Discuss the significance of doing water bacteriology on drinking water for the community.
A: Bacteriological water testing is a method of collecting and analysing water samples to estimate the ...
Q: Calculate the molecular weight of protein in sample A. Given the protein migration distance is 26 mm...
A: In SDS PAGE the protein separates in the denaturing gel used on its relative mobility of charged spe...
Q: helping tags: Biochemistry, polyacrylamide gel electrophoresis (PAGE), SDS PAGE, NATIVE PAGE, gel el...
A: Polyacrylamide gel electrophoresis (PAGE) is a biochemistry technique used to separate biological ma...
Q: DNS could stop enzymatic
A: DNS or dinitro salicylate is an arometic compound that reacts typically with reducing sugar and redu...
Q: What are the glycosidic linkages of the trisaccharide shown? α1→6, α1→6 α1→6, β1→6 ...
A: A molecule synthesized by living organisms or cells is referred to as a "biomolecule." Carbohydrates...
Q: Which are the mono- and dsaccharide hydrolysis products of starch with α-amylase? glucose and ...
A: Alpha amylase hydrolyses alpha linked polysaccharides like starch and glycogen at alpha bond positio...
Q: The base pairing that happens is maintained at around 0.30nm to maintain the diameter of the helix. ...
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each ...
Q: Your friend has a sample of rabbit muscle glycogen phosphorylase that is known to be relatively inac...
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that ...
Q: synthetic membrane (such as dialysis tubing) that has holes large enough for monosaccharides
A: The question is all about the membrane permeability, such that every cell have a cell membrane which...
Q: What structure is shown in the diagram? bases C OH HO- HOH OH CH P-CH CH CH P. O a protein O a polys...
A: We are authorized to answer one question at a time since you have not mentioned which question you a...
Q: Calculate the standard free energy change for each of the following metabolically important enzyme-c...
A: All living organisms are made up of cells, which are the most basic unit of life. They are responsib...
Q: 7. Which set of the following amino acids are all polar? a. W K Q b. H M N c. T N Y d. M T C e. P C...
A: “Since you have asked multiple question, we will solve the first question for you. If you want any s...
Q: The nucleoside monophosphates are seen in metabolic pathways because their phosphoric anhydride bond...
A: All kinds of biochemical reaction follows the thermodynamic principles. While chemical systems tends...
Q: Kindly answer numbers 12, 13, and 14 12. This protein that is involve in immune system responses is...
A: Note - Hi ! Thank you for the question. We are authorized to answer one question at a time. Since yo...
Q: The following is the PCR reaction that is programmed in the thermocycler to amplify the cheek cell D...
A: Polymerase chain reaction (PCR) is a method that is used to amplify a selected region of DNA and pro...
Q: TRUE OR FLASE a) DNA positively supercoils during replication and negatively supercoils in transcri...
A: There are 2 question asked. So we will solve both.
Q: Here is a portion of a cell membrane. By percent weight it is composed of Approximately...
A: The cell membrane contains different macromolecules arranged with each other in orderly manner. The ...
Q: Draw the structure of a polypeptide backbone
A: Polypeptides are polymers or chains of amino acids linked by peptide bonds. The sequence of amino ac...
Q: 4. Create an illustrated step-by-step schematic diagram of the following Qualitative test for Lipids...
A: Lipids are the substances that are soluble in organic solvents like chloroform, and ether and insolu...
Q: Create the chemical equation for the following: 1. Olive Oil + Hubl's solution 2. Oleic acid + Hubl'...
A: Hubl’s solution is made by dissolving three grams of mercuric chloride in thirty milliliters of 95 p...
Q: Imagine you are working in a lab and you examine an unknown cell only to discover it possesses gap j...
A: Gap junctions are cell-to-cell ion channels that allow the rapid diffusion of ions. It allows the mo...
Q: Describe in 4 steps the condensation of eukaryotic DNA to chromosomes. Describe each one briefly. Nu...
A: In mitosis, the nuclear DNA of the cell condenses into visible chromosomes and is pulled apart by th...
Q: 10.18 Using the information in Figs. 10.14 and 10.18, explain how the two oligonucleotides 5'-CAAAGA...
A: Deoxyribonucleotides are the building blocks of DNA. Each nucleotide is composed of five carbon suga...
Q: X Biomolecule present in organisms are essential to one or more typically biological processes excep...
A: Biomolecules plays major role in our body function. They are protein, carbohydrate, lipid, nucleic a...
Trending now
This is a popular solution!
Step by step
Solved in 6 steps
- Why is carboxyl terminal domain (CTD) phosphorylation functionally important?Which of the choices are types of posttranslational modifications a newly synthesized protein may undergo? Select all the choices that apply. changes to hydrogen bonding capabilities formation of an amide bond between Cys and an isoprenyl group removal of prosthetic groups removal of the thiol group from a Cys residue modulation of charges on amino acids proteolytic cleavage covalent attachment of oligosaccharides to Asn, Thr, or SerProtease enzymes cleave proteins by hydrolyzing peptide bonds. The strategy for each type of metalloprotease begins with generating a nucleophile that attacks the peptide bond that attacks the peptide carbonyl group. O Macmillan Learning On the basis of the information provided in the figure, show the next step in the mechanism for peptide-bond cleavage by a metalloprotease. Metalloproteases H R₁ HN Zn Enz 2+ R₂ Draw curved arrows on the pre-drawn structures to show the metalloprotease mechanism. If you need to reset the structures, click More followed by Reset Drawing. Select Draw Templates Groups More B - H Enz H H с R1 | : HN O | Zn 2+ B R2 N Zn Erase
- What type of protein structure does the active form of Catechol-oxidase most likely possess?Aside from asymmetric hydrogenation (Section 29.4), various more strategies for the production of optically active amino acids are currently accessible. How may a process like the Strecker synthesis be modified to produce chiral amino acids?What makes protein phosphorylation so valuable in regulating protein function that its use is ubiquitous?
- The biosynthetic pathway for the two amino acides E and H is shown schematically in the Figure below: A W E 2 Z H How would this pathway change if C was mutated and non-functional?.com/forms/d/e/1 FAlpQLSenLacS5BakgugJMG pBYf0hNjcZaGs2F2MZs4Kn Y10W43JQ/formResponse MCQ Which of the following oligopeptides has net charge equal to zero? O Glutamate - Arginine - Aspartate Lysine O Histidine - Glycine - Tyrosine - Cystine | Glutamate - Alanine - Phenylalanine - Proline O Tryptophan - Methionine - Lysine - ArginineTranslate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stop
- When performing his experiments on protein refolding, Christian Anfinsen obtained a quite different result when reduced ribonuclease was reoxidized while it was still in 8 M urea and the preparation was then dialyzed to remove the urea. Ribonuclease reoxidized in this way had only 1% of the enzymatic activity of the native protein. Why were the outcomes so different when reduced ribonuclease was reoxidized in the presence and absence of urea?What is meant by the term "sugar code"? What are the challenges in the field of glyco-biology?Match the post-translational protein modification to its function. Creates new binding sites by neutralizing positive charges Form protein complexes through quatenary structures Protein localization in the endomembrane system Targets proteins for degradation Creates new binding sites by adding negative charges Lipid anchors Glycosylation Alkylation Polymerization Phosphorylation Aceylation Ubiquitination…