1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG

Q: 63. A student studying mutations found her amino acid chain was…

A: Genetic information is carried by genes to make proteins .  Process includes:-  I ) Transcription II…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: A solution of peptide of unknown sequence was divided into 2 samples. One sample was tre with…

A: Site specific proteases are enzymes that cleaves polypeptide chains only at specific sites i.e. at…

Q: Evaluate the following statements. Which one statement is false?

A: Answer: Central Dogma : It is the complete process of replication , transcription and translation of…

Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…

A:

Q: 7a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: DNA is the genetic material present in most of the living organisms. The DNA is made up of 4…

Q: A small section of a gene for a protein has the following nucleotide sequence: CCT AAG GAT TCA CTT…

A: Introduction  A mutation is a change in the DNA sequence that may occur due to incorrect…

Q: The following sequence has been mutated as follows. What type of mutation is this? Original DNA: 3'…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: A small section of a gene for a protein has the following nucleotide sequence: TAT CTG GCT GTC CAA…

A: Mutation is defined as the sudden and permanent change in the nucleotide sequence of DNA.  Missense…

Q: Which of the following represents the sequence of an RNA transcript for which the template strand of…

A: The deoxyribonucleic acid (DNA) is the nucleotide sequence that stores the genetic information of an…

Q: The sequence below (A) was read from the autoradiogram (B). (A) 5'…

A: Note: since you have asked multiple unrelated questions, as per the honor code we are answering the…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: 28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it…

A: The RNA present in prokaryote and eukaryotic cells, where DNA is main genetic material, is called…

Q: 8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of…

A: Mutation can be defined as change in nucleotide sequence of a gene. Based on the type of change,…

Q: I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: Which one of the following mutations to the coding region of a gene would change the codon reading…

A: A mutation is a change that occurs in the genetic material (DNA) of an organism. Mutations can occur…

Q: What's the mRNA sequence for TACATCTTGGCGACGACT

A: mRNA is a single-stranded RNA that developed during the transcription in a cell. This is also known…

Q: A small section of a gene for a protein has the following nucleotide sequence: CTA TCC CCT ACG TCA…

A: A genetic mutation occurs after the formation of the DNA sequence has been altered. Some mutations…

Q: The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine,…

A: Genetic code is triplet of bases called codon. Genetic code is unambiguous (each triplet specifies…

Q: codons that specify the amino acid Vavne (Val), demonstrating the enet There are Second letter 1U C.…

A: There are 4  codons that specify the amino acid valine, demonstrating the genetic code  is…

Q: Which of the following is most likely to be an RNA nucleotide? a. Adenosine-5'-triphosphate b.…

A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…

Q: 7. A molecule of mRNA from bacteria is shown below: 5'- GUUUCCGAGGAGGCGUAUACAUGUCAGUGGGGGC... -3'…

A: Protein synthesis or translation is the final step of gene expression. This process is divided into…

Q: Identify which regions of DNA encode the protein sequence. Consider that there may be introns (which…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: Which of the following could be the DNA template for the following protein primary structum…

A: The DNA is transcribed to produce the mRNA which gets translated into protein. Proteins are polymers…

Q: List three different mRNA sequences that could encode the amino acid sequence…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: 1. Type uppercase letters for all the DNA bases and leave a blank space between them! DNA: 3'…

A: Transcription and translation are key forms in molecular science that convert the hereditary data in…

Q: 1. Given the anticodon in tRNA is CUU, name the amino acid that will be added.  2. Given the…

A: Since it is a multipart question we are supposed to answer only the first three questions as per the…

Q: 8. The following diagram illustrates a step in the process of translation. fMet Pro mRNA UAC GGG…

A: To identify the locations within the ribosome during protein synthesis (translation) corresponding…

Q: What potential polypeptides can be produced from the following mRNA sequence? There are more than…

A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: 11. Determine the genetic codes for the following sequence of 3 amino acids: Asn-Glu-Ly a. Provide…

A: Amino acids are organic compounds made up of carbon, hydrogen, oxygen and nitrogen atoms. They are…

Q: transcription should be done from the 5' DNA chain. 1. a. 3' DNA: b. 5' DNA: c. mRNA: d. Amino…

A: This exercise involves the process of replication, transcription and translation. In the process of…