.1. Give the complete complimentary bases of the parent DNA strand according to Chargaff's rule and Identify the names of all the genetic codes.- CAG - CCA - TCA – CTG - ACT- GAC - CCC - GAT - TAG - GAG GTC- C F G H. J Val

Q: DNA sequence

A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…

Q: 5' AU Py U A AGGCC G. UGGC G C G GGG What modified nucleoside base is indicated by the arrow?…

A: The answer of the above question is : Pseudouracil (Ψ). Pseudouridine (psi- Ψ)is an isomer of the…

Q: Complete the attached table representing structural characteristics of A, B and Z DNA duplex. A form…

A: DNA can exist in several forms .There are three major forms of DNA are A-DNA, B-DNA and Z-DNA. The…

Q: Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna…

A: In molecular biology, the process of protein synthesis involves the conversion of genetic…

Q: le) Frrors may occur during DNA replication, resulting in a change to the sequence of base triplets.…

A: Through the replication process, the information from one DNA molecule is replicated to create two…

Q: Describe the basic features of the DNA double helix

A: BASIC INFORMATION CELL It is considered as the basic unit of life Every organism is made up of cell…

Q: Which of the following single-stranded DNA sequences is most likely to form a stem-loop structure?…

A: DNA is also called deoxyribonucleic acid. DNA act as the genetic material in all organisms except…

Q: Understand Reverse/forwards strands and reverse complementary strand 5’-GCATGCAT-3’ Write down the…

A: A series of bases in a nucleic acid can form a double-stranded arrangement by combining base pairs.…

Q: Describe the function of DNA polymerase. Explain why each part of the name DNA polymerase (DNA,…

A: DNA polymerase DNA is replicated by enzymes known as DNA directed DNA polymerases or simply DNA…

Q: Describe the basic structural features of DNA-binding proteins that allow them to recognize specific…

A: DNA binding proteins are proteins that have DNA binding domains and thus have a specific or affinity…

Q: SARS-CoV-2 virus infection. Your advisor gives you the double-stranded DNA sequence encoding Peptide…

A: Transcription is the process of formation of a sequence of RNA using DNA as a template. Translation…

Q: elow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: DNA and RNA are the genetic material which have the genetic information about perticular organism…

Q: Acyclovir can be used to treat severe cases of Epstein-Barr viral (EBV) infection, but has little to…

A: Introduction:Acyclovir is an antiviral drug commonly used to treat infections caused by…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Introduction Transcription is a process by which mRNA is produce from DNA. Once the mRNA is formed…

Q: The top side of this figure offers more opportunities (for each base pair) that can lead to highly…

A: A single stranded nucleic acid is formed by joining the nucleotide units together through…

Q: List three important structural motifs in DNA-binding proteins

A: Transcription is the process in which the production of mRNA from one of the strands of DNA, with…

Q: 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the…

A: Transcription is the process of formation of RNA from a DNA. The RNA chain is synthesized in the…

Q: sing the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: The DNA is transcribed into the RNA by the process of transcription and the RNA is translated into…

Q: Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene:…

A: The double-stranded DNA molecule is made up of two DNA strands known as the template strand and the…

Q: One nucleotide strand of a DNA molecule has the base sequence illustrated below. 5′ –ATTGCTACGG–3′…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: In the following gel showing stained bands of the Alu insertion sequence, what is the gem of…

A: In the gel, the presence of a band at 941 bp indicates the presence of the Alu insertion sequence,…

Q: b) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be…

A: The central dogma of molecular biology is the synthesis of mRNA and polypeptide chain by…

Q: Write the complementary sequence of DNA AGCTAT AGC

A: A DNA is a double stranded structure. Both the strands are complementary to each other. Adenine (A)…

Q: The two outside rails of tge double helix are called

A: DNA (deoxyribonucleic acid) belongs to a class of molecules known as nucleic acids. DNA molecules…

Q: All guanines in the top strand of following sequence undergo a chemical change so that they now pair…

A: Two identical DNA molecules, each made up of one original strand (the template strand) and one…

Q: Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT

A: By the process of transcription the DNA strand is transcribed into mRNA within the nucleus of the…

Q: The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using…

A: Introduction  Gene expression is the process through which a gene's information is utilised in the…

Q: if this DNA has a molecular weight of 1.20 ×108 Dalton which contains a head in a about 200 nm long.…

A: Given: DNA - molecular weight = 1.20 ×108 Dalton The molecular weight of a nucleotide pair = 600…

Q: ’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and…

A: Watson and Crick elucidated in 1953 , the famous double stranded structure of the DNA molecule and…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Central dogma refers to the process by which information stored in a DNA molecule is converted into…

Q: From standpoint of replication and transcription, explain how RNA polymerase is allowed to…

A: DNA is a double standard molecule.  RNA is a single standard molecule.  RNA is formed from DNA…

Q: In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: When referring to DNA transcription, the coding strand is the DNA strand whose base sequence is…

Q: Draw the syn conformation of purine residues in Z-DNA.

A:

Q: identify the type of DNA binding motif is shown and the characteristics.

A: DNA stands for deoxyribonucleic acid. A DNA-binding domain consists of a structural motif that…

Q: Give the coordinate for the last base of the first exon for tra-RB; type a number as in 7,000…

A: Introduction :  In mRNA transcripts, introns are referred to as interfering sequences. These are the…

Q: Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and…

A: DNA stands fo deoxyribonucleic acid. It is the genetic material.

Q: Provide the sequences of the template and coding strands of a DNA double helix that was used to…

A: Introduction :- The template strand is a strand of DNA that serves as the blueprint for the…

Q: Explain how DNA-binding proteins can make sequence-specific contacts to a double-stranded DNA…

A: Introduction DNA is an organic chemical that contains genetic information as well as instructions…