Canada

docx

School

Queens University *

*We aren’t endorsed by this school

Course

124

Subject

History

Date

Oct 30, 2023

Type

docx

Pages

2

Uploaded by SargentScience1670

Report
Canada's history is a rich tapestry of Indigenous cultures, European exploration and colonization, and the development of a diverse and multicultural nation. Here is an overview of Canada's history, from its Indigenous origins to the present day: 1. Indigenous Peoples: The history of Canada begins with its Indigenous peoples, who have lived in the region for thousands of years. They include various groups, such as the First Nations, Inuit, and Métis, each with unique cultures, languages, and traditions. 2. European Exploration: European exploration of Canada began in the late 15th century when John Cabot, a Venetian explorer sailing under the English flag, arrived on Canada's east coast. French and English explorers, including Jacques Cartier and Samuel de Champlain, soon followed. 3. Colonization: The French established the colony of New France in the 16th century, with a focus on fur trading. The English, however, gradually gained control of these territories through conflicts like the Seven Years' War. The Treaty of Paris in 1763 officially transferred New France to British control. 4. Confederation and Dominion of Canada: On July 1, 1867, the British North America Act established the Dominion of Canada, uniting the provinces of Ontario, Quebec, New Brunswick, and Nova Scotia. This act laid the foundation for the modern Canadian nation. 5. Expansion and the Westward Movement: The late 19th century saw the expansion of Canada to the west, with the addition of Manitoba, British Columbia, Prince Edward Island, and the Northwest Territories. The construction of the Canadian Pacific Railway played a pivotal role in this expansion. 6. World Wars and International Role: Canada played significant roles in both World Wars and established itself as a respected international actor. The sacrifices of Canadian soldiers during World War I and World War II are commemorated each year on Remembrance Day. 7. Multiculturalism and Official Languages: In 1971, Canada became the first country to adopt multiculturalism as an official policy. The nation recognizes both English and French as official languages.
8. Indigenous Rights and Reconciliation: Canada has worked to address historical injustices and improve relations with Indigenous communities. The Truth and Reconciliation Commission (TRC) was established to investigate the legacy of residential schools and recommend actions for reconciliation. 9. Contemporary Canada: Today, Canada is known for its diverse population, universal healthcare system, social safety nets, and progressive policies. It is a parliamentary democracy with a constitutional monarchy, and its political landscape includes multiple parties. 10. Economic and Cultural Contributions: Canada has a strong economy, known for its natural resources, including oil, minerals, and timber. The nation has also made substantial contributions to the arts, sports, and entertainment, with famous figures in music, film, and literature. 11. Geography and Natural Beauty: Canada is renowned for its vast and stunning landscapes, including the Rocky Mountains, vast forests, pristine lakes, and northern tundra. Its natural beauty attracts visitors from around the world. Canada's history is marked by a continuous journey of exploration, growth, and development. The nation's commitment to diversity and reconciliation reflects a society that values inclusivity and acknowledges its historical challenges, striving to create a better and more inclusive future.
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help

Browse Popular Homework Q&A

Q: Honey bees are visiting two food sites, A and B, at 6 AM in the morning, as shown in Fig. 1 and Fig.…
Q: 1.Equivalent resisitance through entire system 2.Current being drawn from battery 3.Current…
Q: A sign hanging at the local coffee shop has a weight of 400 N. and is supported by a horizontal and…
Q: y=tx ygx cross-section The base of a certain solid is the area bounded above by the graph of y =…
Q: A magnetic field pointing in the y-direction exerts a non-zero torque on a loop of current that lies…
Q: Calculated the requested distance. 1. The distance from the point S(7, 2, 1) to the line: x = -6 +…
Q: graduating from UNC Charlotte with the BS in Biology, you get a job with an agro-chemical company…
Q: Below are six faces. Each face represents a species, with Species 6 being the outgroup. Seven…
Q: What is the function of LARP1 and where does it bind? Select an answer and submit. For keyboard…
Q: mean of 148.4 mg. (a) State the hypotheses for a two-tailed test of the claimed potassium content.…
Q: Please answer one of the following questions in detail, providing examples whenever applicable.…
Q: Distinguish between a chromosomal deletion and duplication.
Q: a. Compute the bond's yield to maturity. b. Determine the value of the bond to you given the…
Q: The position vector of a particle is r(t). Find the requested vector. 1. The velocity at t = pi/4…
Q: Consider a non-classical economy where there are sticky wages in the labor market. When there is a…
Q: The table to the right is based on the assumption that 1% of breast tumors are malignant. It also…
Q: km Two buses leave towns 796 kilometers apart at the same time and travel toward each other. One bus…
Q: The compound methylamine is a weak base like ammonia. A solution contains 9.91x10-2 M CH3NH3+ and…
Q: 1 A M Question 16 CH3 Assign the stereochemistry as R or S.
Q: ental data were obtained when a mixture of CaCO3 and CaO =. Calculate the percent by mass of CaCO3…
Q: s='CTCACAGCTTGAACGGCTGTG'; a=regexp (s, '(..) AA', 'tokens', 'once'); disp (a{1}) (A) A (G) AG (M)…
Q: Rank these species in terms of their relatedness to crocodiles. Place the most closely related on…