BIO2107 Problem Set 2 - Maddyson Jeavons

pdf

School

University of Southern Queensland *

*We aren’t endorsed by this school

Course

2107

Subject

Biology

Date

Jan 9, 2024

Type

pdf

Pages

Uploaded by DoctorElectron650

BIO2107 Cell & Molecular Biology 1 Problem Set #2 - 1 - BIO2107 - CELL& MOLECULAR BIOLOGY I PROBLEM SET TWO (13%) Due via the course Study Desk 23/4/21 Name:_Maddyson Jeavons Total /50 1. A particular sequence containing 6 base pairs is located in 10 different organisms. The observed sequences are: ACGCAC ATACAC GTGCAC ACGCAC ATACAC ATGTAT ATGCGC ACGCAT GTGCAT ATGCGC What is the consensus sequence (include % in your answer)? /3 marks A T G C A C 80% 70% 80% 90% 80% 70% 2. What is the Shine-Dalgarno sequence and why is it important? What structure provides the equivalent function in humans? /4 marks The Shine-Dalgarno sequence is explicitly found in prokaryotes, slightly upwards of the AUG start codon. It is a ribosomal binding site that’s main function is to initiate protein synthesis. The sequence allows the small subunit of the ribosome to bind at exactly the right spot on the mRNA to ensure accurate mRNA translation. In humans, the Shine-Dalgarno sequence is not present.; instead, the 43s ribosome complex recognises the 5’ cap structure and the Kozak sequence, which is found around the first AUG; the 43s complex binds to the 5’ the cap and scans until it finds the first AUG before beginning protein synthesis (Clark and Pazdernik, 2016). 3. RNA interference (RNAi) is a molecular technique with great potential in silencing genes of clinical importance. Currently the efficacy of this approach is hampered by significant technical issues. Explain what these specific issues are and how they might be overcome. /4 marks One issue of RNAi is the risk of off-target effects; only the target gene should be affected in RNAi; however, sometimes this is not the case, and RNAi can affect/alter non-target genes. Whilst specific off targeting may not be a significant concern in many clinical applications,

BIO2107 Cell & Molecular Biology 1 Problem Set #2 - 2 - one strategy to minimise off-target effects includes chemically modifying the RNA to reduce off-target effects (Castanotto and Rossi, 2009) . Another major issue in RNA interference is with the delivery of the RNA to a specific location. Some locations within the body can be more challenging to deliver RNA too. Significant efforts have been made to develop carriers that can overcome obstacles in the delivery process. The two main carrier methods are viral and non-viral; viral vectors are limited in clinical practice due to disadvantages of target effects and potential toxicity. A more recent non-viral carrier is nanoparticles; nanoparticles can be used by coating them in the RNA and sending them through the bloodstream to specific binding sites. They are considered to have many advantages over other delivery systems including, lower toxicity, better biocompatibility, and lower off-target effects (Tian et al., 2021) . 4. You are given a piece of eukaryotic DNA which is shown below /6 marks 5’ - TTACCAGAGATGCATCAGGGCCATTCAAAAATCGGGTCATGAGTG - 3’ a) If this is the coding strand, what is the mRNA produced (label both the 3’ and 5’ ends). 5’ - UUACCAGAGAUGCAUCAGGGCCAUUCAAAAAUCGGGUCAUGAGUG - 3’ b) If this is the template strand, what is the mRNA produced (label both the 3’ and 5’ ends)? 3’ - AAUGGUCUCUACGUAGUCCCGGUAAGUUUUUAGCCCAGUACUCAC - 5’ c) Assuming that the DNA sequence above is the coding strand, predict the amino-acid sequence of the protein produced from the piece of mRNA using single letter codes. In your answer denote both the amino and carboxy ends of the protein. - N- terminal MHQGHSKIGS C-terminal 5. Using the accession number AH002844.2, locate the corresponding DNA sequence in GenBank. Answer the following questions about this sequence: /8 marks a) To what species does this sequence belong? - It belongs to the Homo sapiens insulin (INS) gene. b) How many exons are present in this sequence? - The gene contains 3 exons. c) What do the “N” symbols represent from position 4044? - The “N” symbol represents unknown nucleotide bases. d) What are the first four amino acids in the protein encoded by this gene? - The first four amino acids are Met, Ala, Leu, Trp e) List three post-translational processes that must occur before this protein is fully functional.

BIO2107 Cell & Molecular Biology 1 Problem Set #2 - 3 - - Post-translation is the biochemical modification that occurs to amino acids after the protein has been translated. The three modifications insulin must undergo to become fully functional protein are: 1. Removal of the signal sequence from the polypeptide chain 2. Formation of two disulphide bridge to link the A and B chains of the protein. 3. Removal of the C chain – which then leaves fully functional insulin. f) What is the function of this protein? - Insulin is a hormone produces by the pancreas; its main function is to maintain blood glucose levels by stimulating the uptake of glucose by the cells, which will then store it or break it down for energy resulting in a reduction in blood sugar level. Lack of or resistance to insulin in the body can lead to both type one and two diabetes (Wilcox, 2021). 6. Outline the function of the following genes in the LAC operon. /3 marks Y gene – forms protein lactose permease, which is responsible for transporting lactose across the cell membrane (Montalva-Medel et al., 2021). Z gene – is responsible for producing enzyme beta- β-galactosidase that converts lactose into glucose and galactose (Montalva-Medel et al., 2021). I gene is a regulatory gene responsible for producing a repressor protein that binds to the LAC operon to stop transcription (Montalva-Medel et al., 2021).

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

BIO2107 Cell & Molecular Biology 1 Problem Set #2 - 4 - 7. Study the blot below (from Burleigh et al. (2003) PMB 52: 1077-1088) and answer the following questions: /3 marks a) Which tissue sample had the highest zinc transporter transcription rate? - The roots + Zn b) How have these bands been made visible on the membrane? - The bands have been made visible on the membrane through a northern blot that allows the presence of specific mRNA to be detected to measure the size and amount transcribed (He and Green, 2013). Firstly, gel electrophoresis is used to separate DNA fragments; DNA fragments are then blotted and fixed onto the nitrocellulose membrane before being exposed to a labelled probe and hybridised; after hybridisation has occurred membrane is washed and prepped for an autoradiogram in order to visualise the now labelled DNA fragments (Gilbert, 2021). c) What is the role of the 18S rRNA in the experiment? - 18S rRNA is used as a housekeeping gene in this experiment; its purpose is to show that an equivalent amount of RNA has been extracted from all the different tissue types. The RNA extraction amounts must be the same, so the results are not just because of higher amounts of RNA being extracted from some tissues and lower amounts from others (Bas, Forsberg et al., 2004).

BIO2107 Cell & Molecular Biology 1 Problem Set #2 - 5 - 8. Methylation of K9 of histone H3 (by the enzyme SUV39H1) is associated with heterochromatin formation and gene silencing. It has been reported that methylation of H3 by other enzymes can lead to transcriptional activation. How can methylation lead to opposite effects in cells? /2 marks Methylation of H3 by K9 is generally associated with transcriptional repression however, when H3 is methylated by some other specific enzymes such as K4 it can lead to transcriptional activity (Miller and Grant, 2019). The addition of specific enzymes can make DNA more accessible for transcription, for example methylation with these enzymes can cause histones to slide along the DNA thus making DNA promoter sites more accessible for RNA polymerase to access and begin transcription. 9. In an experiment you extract and separate the DNA and mature mRNA from a cell. You then denature the DNA and place the mRNA in the same tube and allow the mRNA and DNA to anneal together. You then look at the result under an electron microscope where you see the following: /3 marks a) Determine which of the strands shown is mRNA and which is DNA: Strand A = DNA Strand B = mRNA b) Determine the number of: Introns = 6 Exons = 7 c) If you did the same experiment again but used the primary (unedited) mRNA transcript would the picture look different (please draw a diagram to illustrate your answer)? -

BIO2107 Cell & Molecular Biology 1 Problem Set #2 - 6 - 10. One of largest known polypeptide chains in humans is the muscle cell-located dystrophin, which has a molecular weight of 427 kDa. How long (in minutes) would it take a muscle cell to translate an mRNA coding for dystrophin? Assume the average molecular weight of an amino acid is 120 daltons and that the translation rate is two amino acids per second in eukaryotic cells. /3 marks Polypeptide weight = 427kDA = 427000 daltons Amino acid weight = 120 daltons Translation rate = 2 amino acids per second 427000/120 = 3558.33 units 3558.33/2 = 1779.17 1779.17/60 = 29.65 minutes Answer = 29.65 minutes 11. The following drugs impair gene expression in cells. Outline the specific inhibitory mechanism for each. /5 marks Rifampicin – blocks the initiation of transcription by inhibiting RNA polymerase. Geneticin – inhibits the elongation step in both prokaryotic and eukaryotic cells to block polypeptide synthesis (Scholar, 2021). Streptomycin – binds to the 16s rRNA ribosome, which interferes with the binding of formyl- methionyl-tRNA to the 30s subunit to prevent initiation of protein synthesis (Waters and Tadi, 2021). Fidaxomicin – inhibits bacterial RNA polymerase in the early stages of transcription to stop protein synthesis (Babakhani et al., 2021). Alpha-amanitin – inhibits protein synthesis by blocking RNA polymerase II and III (Bensaude, 2021).

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

BIO2107 Cell & Molecular Biology 1 Problem Set #2 - 7 - 12. The chimpanzee, Pan troglodytes , is our closest living relative. Humans and chimps evolved from a common ancestor that lived approximately 6 million years ago. /6 marks a) How similar are the alpha-globin and beta-globin proteins of humans and chimpanzees? Haemoglobin is a major blood protein that consists of four amino acid chains, two alpha and two beta globin’s (Gauri, Srivastava and Das, 2011). When analysing the haemoglobin chains of humans and Pan troglodytes , it can be identified that there is no difference between the haemoglobin chains of humans and chimps. b) How similar are the alpha-globin and beta-globin genes of humans and chimpanzees? Even though the proteins are identical between humans and chimpanzees, the genes that code them are not. There are multiple differences between the introns, and exons are the same between humans and chimpanzees. There is a difference of 15 introns and one exon between the species; this is due to the genetic code being degenerate, meaning more than one codon can code for the same amino acid. There is, however, a match to a gene on the number 11 chromosome of the chimpanzee. c) Are the amino acid sequences of the proteins or the nucleotide sequences of the genes more similar? Why? The amino acid sequences of the proteins are more similar. This is because the alpha-globin and beta-globin are identical whilst there is more difference between the genes of humans and Pan troglodytes. Comparing amino acid sequences tend to be better as due to there being 20 amino acids, the sensitivity of comparison is better than when comparing nucleotide sequences as they only have four bases and tend to have more random matches.

BIO2107 Cell & Molecular Biology 1 Problem Set #2 - 8 - Reference List Babakhani, F., Bouillaut, L., Gomez, A., Sears, P., Nguyen, L. and Sonenshein, A., 2021. Fidaxomicin Inhibits Spore Production in Clostridium difficile . [online] Available at: <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3388029/#:~:text=Fidaxomicin %20inhibits%20bacterial%20RNA%20polymerase,the%20rifamycin%20family% 20%5B19%5D.> [Accessed 18 April 2021]. Bas, A., Forsberg, G., Hammarstrom, S. and Hammarstrom, M., 2004. Utility of the Housekeeping Genes 18S rRNA, beta-Actin and Glyceraldehyde-3- Phosphate-Dehydrogenase for Normalization in Real-Time Quantitative Reverse Transcriptase-Polymerase Chain Reaction Analysis of Gene Expression in Human T Lymphocytes. Scandinavian Journal of Immunology , 59(6), pp.566-573. Bensaude, O., 2021. Inhibiting eukaryotic transcription. Which compound to choose? How to evaluate its activity? . [online] NCBI. Available at: <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3173647/> [Accessed 18 April 2021]. Castanotto, D. and Rossi, J., 2009. The promises and pitfalls of RNA-interference- based therapeutics . [online] NCBI. Available at: <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2702667/pdf/nihms117711.p df> [Accessed 20 April 2021]. Clark, D. and Pazdernik, N., 2016. DNA, RNA, and Protein. Biotechnology , 2, pp.33-61. Gauri, A., Srivastava, G. and Das, A., 2011. Comparative evolutionary analyses of beta globin gene in eutherian, dinosaurian and neopterygii taxa . [online] Mrcindia.org. Available at: <http://www.mrcindia.org/journal/issues/481027.pdf> [Accessed 22 April 2021]. Gilbert, S., 2021. RNA Localization Techniques . [online] Ncbi.nlm.nih.gov. Available at: <https://www.ncbi.nlm.nih.gov/books/NBK10051/> [Accessed 20 April 2021]. He, S. and Green, R., 2013. Northern Blotting. Laboratory Methods in Enzymology: RNA , 530, pp.75-87. Miller, J. and Grant, P., 2019. The Role of DNA Methylation and Histone Modifications in Transcriptional Regulation in Humans . [online] NCBI. Available at: <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6611551/> [Accessed 23 April 2021].

BIO2107 Cell & Molecular Biology 1 Problem Set #2 - 9 - Montalva-Medel, M., Ledger, T., Ruz, G. and Goles, E., 2021. Lac Operon Boolean Models: Dynamical Robustness and Alternative Improvements. Mathematics , [online] 9(6), p.600. Available at: <https://www.mdpi.com/2227-7390/9/6/600/htm> [Accessed 21 April 2021]. Scholar, E., 2021. Geneticin - an overview | ScienceDirect Topics . [online] Sciencedirect.com. Available at: <https://www.sciencedirect.com/topics/chemistry/geneticin> [Accessed 18 April 2021]. Tian, Z., Liang, G., Cui, K., Liang, Y., Wang, Q., Lv, S., Cheng, X. and Zhang, L., 2021. Insight Into the Prospects for RNAi Therapy of Cancer. Frontiers in Pharmacology , 12. Waters, M. and Tadi, P., 2021. Streptomycin . [online] Ncbi.nlm.nih.gov. Available at: <https://www.ncbi.nlm.nih.gov/books/NBK555886/> [Accessed 18 April 2021]. Wilcox, G., 2021. Insulin and Insulin Resistance . [online] PubMed Central (PMC). Available at: <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1204764/#:~:text=Insulin%2 0is%20a%20peptide%20hormone,growth%20through%20its%20mitogenic%2 0effects.> [Accessed 17 April 2021].

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

BIO2107 Problem Set 2 - Maddyson Jeavons

Related Documents