E30A2910-5409-4AED-85D8-45FA4D1933CB

pdf

School

Pennsylvania State University *

*We aren’t endorsed by this school

Course

230W

Subject

Biology

Date

Apr 3, 2024

Type

pdf

Pages

10

Uploaded by MasterLlamaMaster1106

Report
BIOL230W Week 4 – Making Protein (Translation) 1 We are continuing our journey following the flow of information in a cell. Last week we focused on transcription. We discussed how the information is transferred from the genome (DNA) to a mRNA molecule and how this expression can be regulated resulting in differential gene expression. This week we will be discussing transferring the information in the mRNA into a functional protein. This process is known as translation. Day 1 Learning Objectives 1. Explain how mRNA is translated into different locations (cytoplasm vs. ER) and how this impacts final protein localization (cytoplasm vs. export vs. membrane). 2. Describe the structure and the role of the translocon, Sec 61, in the localization of proteins. 3. Describe the role of the amino acid side chain in the function of a proteins. 4. Describe the role of a peptide bond. 5. Explain the importance of R-groups or side chains in protein function. 6. Compare and contrast a DNA polymer and a polypeptide. 7. Describe the structure of tRNA and how its structure contributes to function. Central Dogma Recap Last week we determined that there is a deletion in the DNA of a patient (Maggie) with cystic fibrosis. This week we want to continue our exploration of how this different genotype results in a different phenotype. Use the image on the screen to answer the following questions. 1. Where, in relation to the cell, do proteins function (Hint - think of three general areas)? 2.Which organelle will “read” the information in the mRNA and convert it to a protein sequence? 3. Where in the cell is the ribosome located at the start of translation? What two locations can translation be terminated? Mini-Lecture: Co-translation Translocation Look out for the answers to these questions during the mini-lecture! 4. The translocon allows passage between which two areas of the cell? 5. If the signal peptide of a new protein directs the ribosome to the translocon, would it need to be translated first or last? 6. If translated through the translocon, where would be the protein’s ultimate destination? cytoplasm , plasma membrane , lysosome , or outside the cell ribosomes In the cytoplasm ; rough ER the cytoplasms the ER Lumen last : finishes translation into the ER endosome
BIOL230W Week 4 – Making Protein (Translation) 2 7. What characteristic do amino acids that span the hydrophobic core of a membrane share? Small Group Discussion: What is a protein? 8. What monomers make up a protein polymer? 9. What makes one amino acid different from another? 10. What is the name of the bond that connects monomers into the polymer (polypeptide)? Small Group Discussion: Compare and contrast polypeptide and DNA polymer. 11. How is a polypeptide analogous to a molecule of DNA or mRNA? 12. How are they different? Mini-Lecture: (Ready!) Player 1 - tRNA Now that we have all that information from the DNA transcribed to RNA, how is the information in a mRNA translated to the language of protein? We will be focusing on three main “players” or molecules that complete this process: tRNA, G-proteins, and the ribosome. The first player is another non-coding RNA molecule, tRNA, that acts as an adapter between the two languages! 13. Using the image on the screen, describe in your own words how the tRNA molecule facilitates the transfer of information from the mRNA into a polypeptide.
BIOL230W Week 4 – Making Protein (Translation) 3 Day 2 Learning Objectives 1. Identify the states where G-proteins are activated and inactivated. 2. Explain the role of G-proteins in the elongation process of translation. 3. Describe the structure of a ribosome and how its structure contributes to its function (eg. ribozyme function, A-site, P-site, E site). 4. Compare and contrast the function of different non-coding RNAs we have discussed in class. 5. Outline the factors (proteins) and the sequence of events involved in initiation of translation. 6. Analyze the interaction of codons and anticodons and match them to the appropriate amino acid using the provided genetic code. 7. Describe how the genetic code is redundant and how it affects codon:anticodon pairing (wobble). 8. Outline the major steps of translation (initiation, elongation, termination) using appropriate key words. Small Group Discussion: Player 2 - G-proteins Using the image on the screen answer the following questions: 1. G-proteins bind to a variety of target proteins in addition to one common molecule. What molecule do all G-proteins bind to and eventually hydrolyze? 2. G-proteins are active when bound to what molecule? 3. G-proteins are inactive when bound to what molecule? Mini-Lecture: Player 3 – Ribosome (rRNA, proteins and ribozyme) 4. RNA molecules that catalyze reactions are called ______________. 5. Why are ribosomes classified as ribozymes?
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
BIOL230W Week 4 – Making Protein (Translation) 4 Small Group Activity: Elongation of Translation Using Figure 1 answer the following questions concerning the three main events required for elongation, the process of building a polypeptide from the information in an mRNA molecule. Figure 1 . Steps of elongation. Step 1: Binding of aminoacyl tRNA. 6. What is the name and function of the G-protein in this step of elongation? 7. If the mRNA codon 5’ ACU 3’ is in the A-site of the ribosome, what is the sequence of the complementary tRNA anticodon 5’_______ 3’ and which amino acid would be added? 8. If the anticodon 5’ ACU 3’ is found on the incoming aminoacyl tRNA, which amino acid would it be carrying?
BIOL230W Week 4 – Making Protein (Translation) 5 Step 2: Peptide bond formation – Ribozyme! 9. Describe the covalent bond that is formed (give the name of the bond and what molecules it connects) and the bond that is broken (what molecules was the bond connecting) by the peptidyl transferase (i.e., the ribozyme) center =of the ribosome? 10. Compare and contrast the ribozyme with the other non-coding RNAs we have talked about so far. Step 3: Translocation 11. How many nucleotides does the ribosome move during translocation (not shown in image)? 12. What is the name of the G-protein that functions in this event? Small Group Activity: Elongation Practice 13. Now think back to Maggie’s DNA. Using the provided genetic code, translate Maggie’s mRNA and compare it to the protein sequence of the individual without CF. Figure 1. Sequence of the CFTR gene from an individual without CF. Primary Transcript (pre-mRNA): 5’ GCGUAUGAAAAACAGUUGCAG ...... AUCAUCUUUGGU...CGGUAAAGC ...3’ Mature mRNA: 5’ GCGUAUGAAAAACCAG ...... AUCAUCUUUGGU...CGGUAAAGC ...3’ Amino Acid Sequence:
BIOL230W Week 4 – Making Protein (Translation) 6 Figure 2. Sequence of the CFTR gene from an individual with CF. Primary Transcript (pre-mRNA): 5’ GCGUAUGAAAAACAGUUGCAG ...... AUCAUCGGU...CGGUAAAGC ...3’ Mature mRNA : 5’ GCGUAUGAAAAACCAG ...... AUCAUCGGU...CGGUAAAGC ...3’ Amino Acid Sequence: 14. What is different between Maggie’s protein and the individual without CF? 15. What is the characteristic of the phenylalanine side-group? Figure 2. The universal genetic code. Use this table to match codons to their respective amino acids. Note the codons are organized such that the first nucleotide of the codon in each row is listed to the left of the table and the second on the top. The third is listed to the right. The sequence listed is the sequence of the CODON from 5’ to 3’. Mini Lecture: Wobble and Translation Termination
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
BIOL230W Week 4 – Making Protein (Translation) 7 Day 3 Learning Objectives: 1. Describe the different levels of protein structure (primary, secondary etc…). 2. Explain which interactions dictate the levels of protein structure. 3. Compare and contrast structural motifs (super-secondary structure) and domains. 4. Compare and contrast and identify the 3-dimensional structures of different proteins using domain box diagrams, ribbon diagrams and ball and stick diagrams Small Group Discussion: CFTR Protein Structure. Now that the protein has been translated it needs to fold into a structure that will allow it to be transported and function correctly. This will involve the interaction of atoms at several levels within the polypeptide and sometimes with other polypeptides, as well. Use the image of Figure 3 on the screen to answer the following questions. Figure 3. Ribbon diagram of the CFTR protein. The image on the left shows a normal CFTR protein and the image on the right indicates a protein harboring the ∆F508 mutation. Tubular structures represent alpha helices and flat arrow indicate beta strands. Indicated in yellow is the phenylalanine that is missing in the ∆F508 mutant as well as the two amino acids upstream of the phenylalanine for purposes of comparison in the mutant. 1. From Day 2, is there a change in primary structure in the mutant? 2. What secondary structures do you see in the images? 3. Is there a change in secondary structure? 4. Is there a change in tertiary structure? 5. Is there a change in quaternary structure?
BIOL230W Week 4 – Making Protein (Translation) 8 Figure 4. Stick and ball representation of the normal and ∆508 mutant CFTR proteins. (Left) Shown in yellow are the phenylalanine amino acid that is missing the ∆508 mutant as well as the tryptophan that it interacts with on the interior of the protein. (Right) Shown in yellow are the amino acids proximal to the missing phenylalanine (above) and the tryptophan (below) that is now been positioned toward the exterior of the protein. 6. What is the characteristic of the phenylalanine side-group? 7.Where would you expect a phenylalanine to be located in a 3-D protein (on surface or in the interior)? 8. What other amino acids would you expect to interact with phenylalanine in the center of the protein? 9. What is the characteristic of the tryptophan side-group? 10. What does the change in position of the tryptophan in the mutant suggest about the folding of the protein? hydrophic In the interior ... away from the aqueous environment other hydrophic side groups ... tryptophan also very hydrophobic It is not folding properly ... should be in the center ... it is hydrophic , but now It is on the outer edge , flipped out ⊥ misfolded protein
BIOL230W Week 4 – Making Protein (Translation) 9 Mini lecture: Hierarchy of Protein Structure Small Group Discussion: Examining Protein Domains Figure 6. (A) Domain diagram of RecQ helicases from several organisms. These proteins function in DNA repair. The Zn-binding motif (brown), unique to the RecQ family, is depicted in the C-terminus of the ATPase domain. Most RecQs also share the HRDC ( h elicase-and- r ibonuclease D / C -terminal) domain at the C-terminus, although it is not essential for helicase activity. A nuclear localization signal is depicted as a shaded bar. (B) Structure of WRN RQC domain (blue, ribbon model) bound to the 14- base-pair DNA molecule (orange, tubular model). The secondary and supersecondary structures are labeled. Side chains of the key interacting amino acids are shown as stick models. (C) A view following 90° rotation along the y- axis. 11. In Fig 6(A), what do the “boxed” structures represent? What do the thinner lines represent?
Your preview ends here
Eager to read complete document? Join bartleby learn and gain access to the full version
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help
BIOL230W Week 4 – Making Protein (Translation) 10 12. Does the E. coli protein have more or less domains compared to the WRN human? Why is this evolutionarily important? 13. What hierarchy of structure is represented in Fig 6 (B) and (C)? 14. Does helicase activity require energy (*hint, look at domain functions)? Why or why not? 15. Are there any supersecondary structures represented in the figure? How do these generally differ from domains? 16. What secondary structures (sheets, helices or both) appear to lead to the association of WRN with one of the grooves of DNA? (*hint – what part of the domain appears to be interacting with the nucleobases?) Optional End of Week 3 Summary Drawing Summarize what you have learned this week with a drawing in the space below. Draw and label a ribosome translating an mRNA. Include the ribosome (both subunits), the mRNA (5’ and 3’ ends labelled), an uncharged tRNA, and aminoacyl tRNA, and active and an inactive EF-Tu, a start and a stop codon. Add anything else you can think of! Note: Drawing is a research-supported strategy to retain information, so we encourage you to complete this for practice.

Related Documents

Assignment #2 Genetics assignment for DNA class Spring 24.pdf
Discussion 2-1.pdf
Discussion 5 (1).pdf
RCP130.NIV.Assignment.docx
BIOL 2120 CH. 16 Case Study.docx
bvalchar_assignment10.1.docx
Week 10 Student.pdf
Lesson 13_GRQs_Flow of Genetic information Part 1.pdf
Lesson 17_GRQs_Reproduction Part 2.docx
173 Exam 2 Example Questions.docx
BIOL2368_Microbiology_2023_Practical_Logbook_26012023-1.docx
Notes%20for%20BIOL.pdf.pdf
Recommended textbooks for you
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Text book image
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Text book image
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
SEE MORE TEXTBOOKS
Recommended textbooks for you
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Text book image
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Text book image
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
SEE MORE TEXTBOOKS