BIOL2000 Problem set Chapter 8

docx

School

University of Waterloo *

*We aren’t endorsed by this school

Course

239

Subject

Biology

Date

Apr 3, 2024

Type

docx

Pages

1

Uploaded by AgentHummingbirdMaster1077

Report
Q 31. Draw the longest continuous base-pairing interaction between the following RNAs: 5 -AAUGCCGGUAACGAUUAACGCCCGAUAUCCG-3 5 -GAGCUUCCAUAUCGGGCGUUGGUGAUUCGAA-3 Q32. What role does the branch point ribose 2 -OH play in the splicing reaction? Q 37. What is the primary function of the sigma factor in bacteria? Is there a factor in eukaryotes that is functionally analogous to the sigma factor? Q38. Write the sequence of the template and non-template strands of DNA that encode the following fragment of a bacterial mRNA: pppGUUCACUGGGACUAAAGCCCGGGAACUAGG Q39. Write the sequence of the template and non-template strands of DNA that encode the following eukaryotic mRNA, where the underlined sequence is the poly(A) tail: m7GpppGUUCACUGGGACUGAAUAAAGGGAACUAGGAAAAAAAAAAAAA(n = 150) Q 49. If you isolated an mRNA from a eukaryotic cell, what features would it have at its 5 and 3 ends if it is full length? Q50. If you had the sequence of an mRNA and the genome of a new organism, how would you determine the location in the genome of the transcription start site of the gene that encodes the mRNA? Q 53. In bacteria and eukaryotes, describe what else is happening to an mRNA while RNA polymerase is synthesizing it from the DNA template.
Discover more documents: Sign up today!
Unlock a world of knowledge! Explore tailored content for a richer learning experience. Here's what you'll get:
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help