BIOL2000 Problem set Chapter 9

docx

School

University of Waterloo *

*We aren’t endorsed by this school

Course

239

Subject

Biology

Date

Apr 3, 2024

Type

docx

Pages

Uploaded by AgentHummingbirdMaster1077

Q26 a. Use the codon dictionary in Figure 9-8 to complete the following table. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. b. Label the 5 and 3 ends of DNA and RNA, as well as the amino and carboxyl ends of the protein. ′ ′ Q27. Consider the following segment of DNA: 5 GCTTCCCAA 3 ′ ′ 3 CGAAGGGTT 5 ′ ′ Assume the top strand is the non-template strand used by RNA polymerase. a. Draw the RNA transcribed. b. Label its 5 and 3 ends. ′ ′ c. Draw the corresponding amino acid chain. d. Label its amino and carboxyl ends. Repeat parts a through d, assuming that the top strand is the template strand. Q28. A mutational event inserts an extra base pair into DNA. Which of the following outcomes do you expect? (1) No protein at all; (2) a protein in which one amino acid is changed; (3) a protein in which three amino acids are changed; (4) a protein in which two amino acids are changed; (5) a protein in which most amino acids after the site of the insertion are changed. Q29. a. In how many cases in the genetic code would you fail to know the amino acid specified by a codon if you knew only the first two nucleotides of the codon? b. In how many cases would you fail to know the first two nucleotides of the codon if you knew which amino acid is specified by it?

Q30. If a polyribonucleotide contains equal amounts of randomly positioned adenine and uracil bases, what proportion of its triplets will encode (a) phenylalanine, (b) isoleucine, (c) leucine, (d) tyrosine? Q 31. In the fungus Neurospora, some mutants were obtained that lacked activity for a certain enzyme. The mutations were found, by mapping, to be in either of two unlinked genes. Provide a possible explanation in reference to quaternary protein structure. Q35. In bacterial genes, as soon as a partial mRNA transcript is produced by RNA polymerase, the ribosome assembles on it and starts translating. Draw a diagram of this process, identifying 5 and 3 ′ ′ ends of mRNA, the amino and carboxyl ends of the protein, the RNA polymerase, and at least one ribosome. Why couldn’t this system work in eukaryotes? Q48. A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the DNA cause a protein change in sequence from Phe-Ser-Pro-Arg-Leu-Asn-Ala-Val-Lys to Phe-Val-His-Ala-Leu-Met-Ala-Val-Lys a. What are the old and new mRNA nucleotide sequences? Use the codon table in Figure 9-8. b. Which nucleotide has been added? Which has been deleted? Q49. You are studying an E. coli gene that specifies a protein. A part of its sequence is –Ala–Pro–Trp–Ser–Glu–Lys–Cys–His– You recover a series of mutants for this gene that show no enzymatic activity. By isolating the mutant enzyme products, you find the following sequences: Mutant 1: –Ala–Pro–Trp–Arg–Glu–Lys–Cys–His– Mutant 2: –Ala–Pro– Mutant 3: –Ala–Pro–Gly–Val–Lys–Asn–Cys–His– Mutant 4:

–Ala–Pro–Trp–Phe–Phe–Thr–Cys–His– What is the molecular basis for each mutation? What is the DNA sequence that specifies this part of the protein? Q51. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT a. Which strand of DNA is the template strand, and in which direction is it transcribed? b. Label the 5 and 3 end of each strand. ′ ′ c. If an inversion occurs between the second and the third triplets from the left and right ends, respectively, and the same strand of DNA is transcribed, how long will the resultant polypeptide be? d. Assume that the original molecule is intact and that the bottom strand is transcribed from left to right. Give the RNA base sequence and label the 5 and 3 ends of the anticodon that inserts the fourth amino ′ ′ acid into the nascent polypeptide. What is this amino acid?

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

Related Documents

Lecture Exam 4 Practice_S22.docx

Thomas_Sierra_Biol 150 Lab Exam 1 Review FALL2020(1)(2).docx

Choi, James_Report_Digestion Analysis.pdf

Biol2000 Problem set Chp 2-3.docx

BIOL2000 Problem set Chapter 8.docx

Problem set Chapter 6.docx

FA16_Student_Intro_to_Inverst Lab Sheet-1.docx

FA19_Student_Protista and Fungi Lab Sheet.docx

Unit2A Problem Set (1).pdf

8.12 Radish Seed lab-LD only-2.pdf

5_Project.docx

lab 4 pdf.pdf

Recommended textbooks for you

Biochemistry

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Cengage Learning

Biology (MindTap Course List)

Biology

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...

Biology

ISBN:9781305251052

Author:Michael Cummings

Publisher:Cengage Learning

Biology 2e

Biology

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:OpenStax

Biology Today and Tomorrow without Physiology (Mi...

Biology

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cengage Learning

SEE MORE TEXTBOOKS

Recommended textbooks for you

Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning