lab 4 pdf

pdf

School

Stockton University *

*We aren’t endorsed by this school

Course

1405

Subject

Biology

Date

Apr 3, 2024

Type

pdf

Pages

Uploaded by MinisterPonyPerson917

Biodiversity & Evolu0on Lab Melissa Laurino 1 Biodiversity & Evolu0on Lab 4 – Bacteria and Archaea ___/20 Points Learning objec0ves: A"er comple+ng this ac+vity, students should be able to … ● Use traits to reconstruct a phylogeny of microbial species ● Infer why a cyanobacteria behavior is an adap0ve trait ● Use DNA sequences to iden0fy bacteria There are so many bacteria and archaea that to try and sum up everything in a single lab is like trying to give you world history in three hours – it can’t be done. Today, we’ll brieﬂy dip our collec0ve minds into the world of prokaryotes , focusing on a few intriguing aspects of bacteria. Part 1 – Microbial Evolu0on and Diversity Overview As you are now aware, evolu0on can be studied over deep 0me by looking at fossils, but also from comparing living (extant) species. For example, by comparing the traits of maple, oak, and pine trees you should be able to infer that the oak and maple have a more recent common ancestor and that the pine tree is a distant rela0ve. Based on this basic understanding we could propose a “phylogene0c tree” that shows the evolu0on of these three lineages (see below). In this exercise you will be provided with traits and images of a set of real microorganisms and then asked to use this informa0on to try to infer their evolu0onary history (their phylogene0c rela0onships) aQer you have classified these microbes based on their traits. There is more than one way to group the microorganisms, so you should be prepared to give the ra0onale for your groupings. The main objec0ve is to consider the different characteris0cs (traits) to classify these microorganisms and discuss with others why some characteris0cs might be beUer to priori0ze in this classifica0on. 1. Examine the 8 Microbe Card images (Powerpoint file .ppt). 2. Note the similari0es and differences among the microorganisms. Select 2 traits you think will best inform you about the rela0onships of these microbes. Brieﬂy explain why you think these traits will be helpful (1): The traits that will be used to compare are carbon source and lifestyle. Five of them have carbon dioxide as their c-source and have similar lifestyles with hydrothermal systems and photosynthesis.

Biodiversity & Evolu0on Lab Melissa Laurino 2 3. Arrange the microbes into several groups based on shared traits (The two traits you are the assumed homologies). 4. Next try to decide rela0onships between your different groups. Which of your groups seem more closely related to other groups? Why? 5. Then break the groups into finer branches on your phylogene0c tree. Remember all these microbes are extant species. 6. Construct a phylogene0c tree for all of the microorganisms in the PowerPoint file based on the 2 traits you selected. Take a screen shot and input it here (5):

Biodiversity & Evolu0on Lab Melissa Laurino 3 The instructor will now show you a phylogene0c tree (cladogram) based on molecular data for these 8 species. 1. How close was your phylogene0c tree compared to the one reconstructed from molecular data? What role do you think convergent evolu0on played in effec0ng how you reconstructed your phylogeny (2)? The phylogene0c tree was similar to the reconstructed one. Convergent evolu0on goes saying some species share the same traits as others and some descendants share others ancestral traits too. Part 2 – Cyanobacteria Cyanobacteria photosynthesize and thus provide us with some of the oxygen we breathe. Today, you and your lab partners will examine one kind of cyanobacteria called Oscillatoria . Oscillatoria live in colonies of filaments that “oscillate,” or move, and you can observe this behavior under the microscope. Today, you will test the following hypothesis based on observa0ons of this bacterium: Hypothesis : The rate at which Oscillatoria moves is correlated with the brightness of the light. The null hypothesis is that the rate of movement for Oscillatoria will not change significantly when light levels are different. IMPORTANT – Before you begin this por0on of the lab, each table should acquire a compound microscope, a slide, and a sample of Oscillatoria from the instructor. Follow your instructor’s direc0ons regarding how to use the microscope appropriately. To test the hypothesis that the rate at which Oscillatoria moves is correlated with light intensity, you will first find and iden0fy Oscillatoria on your group’s slide. Make sure you have correctly iden0fied and can see the bacteria directly and without ques0on through the microscope – have your lab instructor double check your iden0fica0on. Then, you will set the light at one level and record how many 0mes you observe Oscillatoria to move in one minute. Do this three 0mes at one light level and take the average. Then, you will repeat this series of recordings at another light level, and again at another light level. For example, you will take 3 readings at light level 1 (low light), and 3 readings at light level 2 (bright light). NOTE : Obviously, you can’t set the light so low you can’t see the bacteria movement – so choose as your lowest light level something that will allow you to s0ll see your specimen! Fill out the table below (8): Light Level 1 (Low) Light Level 2 (High) # of Movements/min 12 29 # of Movements/min 10 28

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

Biodiversity & Evolu0on Lab Melissa Laurino 4 1. AQer your experiment, what did you find? As the light levels increased, was there a quan0ta0ve difference in how oQen the Oscillatoria moved? If so, how did the number of movements change – did they increase or decrease (1) As the light increased, the movement got higher, and as the light dimmed, the movement decreased. The average movement for low light was 10.67 and the average movement for high light was 28.67. 2. Oscillatoria moves because that trait has been selected for – fitness of Oscillatoria colonies has increased because of this adapta0on. Why do you think so? In other words, what advantage might there be to survival living in a colony that twitches and moves in rela0on to light (1) This observa0on may have happened to prevent detec0on of movement from predators. An advantage could be darkness is a good environment to live in to avoid danger. Part 3 – Why are there bacteria in yogurt? Many manufacturers of yogurt add probio0c bacteria to their product. Probio0cs are live microbial food supplements or their components, which have been shown to have beneficial effects on human health. The probio0c bacteria added to yogurt may improve intes0nal tract health, enhance the immune system, reduce symptoms of lactose intolerance, decrease the prevalence of allergy in suscep0ble individuals, reduce risk of certain cancers, and lower serum cholesterol concentra0on. Because different bacteria may have similar shapes, iden0fying bacteria based on their appearance and morphology can be challenging. Microbiologists typically classify bacteria based on their metabolism and DNA sequences. Because bacteria reproduce asexually by binary fission, the parental bacteria pass their gene0c informa0on on to their daughter cells. Bacteria that are more closely related will have more similari0es in their DNA sequences. This can be expanded to an evolu0onary 0me scale where similar DNA sequences between different prokaryo0c organisms indicate phylogene0c relatedness. One of the specific genes oQen used by researchers to iden0fy and classify bacteria and archaea encodes the 16S ribosomal RNA (rRNA) gene. This gene encodes the major RNA component of the small subunit of the ribosome structure that is required by all cells for protein synthesis. The phylogene0c tree (Figure 1) across all domains is based on a comparison of the DNA sequence of the small subunit RNA gene. In this exercise, you will iden0fy organisms found in yogurt using a por0on of the 16S rRNA genes from the microorganisms found in yogurt. Your instructor will provide you with a par0al unknown 16S rRNA sequence for between one and five microorganisms, which you will iden0fy using the Basic Local Alignment Search Tool (BLAST) through the Na0onal # of Movements/min 10 29 Average # of Movements/min 10.67 28.67

Biodiversity & Evolu0on Lab Melissa Laurino 5 Center for Biotechnology Informa0on at the Na0onal Ins0tutes of Health . Demo video: hUps://www.loom.com/share/3f553ca7a2e94a00afafc5ba3d99f491 You will be given one or more nucleo0de sequence(s) in FASTA format that will look something like this: >Unknown Bacteria Sample 1 GAGGATAATACCCTTGGGTCTTGACGTTACCTTTAGAAGAAGCACCGGCTAACTCCGTGCCAG CAGCCGCGGTAATACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGC GGCTTGTTAAGT Perform a BLAST search to iden0fy the organism as follows. a. Open a web browser and navigate to www.ncbi.nlm.nih.gov This will take you to the NCBI website. Along the right-hand side, you will find a list of Popular Resources. b. Click on the BLAST link . This will take you to the BLAST home page. Because you will be using a nucleo0de sequence, choose nucleo0de blast from the selec0on of Basic BLAST tools on the middle of the page. c. Cut and paste your FASTA formaUed sequence into the box listed under Query Sequence box as shown below. d. Under Choose Search Set, Database, select Others (nr etc.). From the pull-down menu select Reference RNA sequences. e. Under Program selec0on, select Somewhat similar sequences (blastn). Click the BLAST buUon and your search will begin.

Biodiversity & Evolu0on Lab Melissa Laurino 6 f. Choose the first result that contains a named species, eg: Escherichia coli showing the 16s rRNA gene. This is one of the ways that biologists preliminarily iden0fy organisms. For a more accurate iden0fica0on, addi0onal genes and/or addi0onal regions of the 16s rRNA gene are further analyzed. Answer the following ques0ons: 1. Name of the specific DNA sequence you used in the exercise (your Query sequence – in other words, did you use sequence #2 or #3?) #_3_ 2. What is the Genus species name of the organism in the NCBI database that was the best match to your query sequence? YOU MUST ITALICIZE THE NAME AND remember that the Genus name is capitalized but the species name is not (2). The genus name is Streptococcus thermophiles strain.

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

lab 4 pdf

Related Documents