available sites in your sequence so you'll have to engineer RE cut sites into the 5' ends of your primers.
You'll use KpnI
at the 5' end of the sequence, and
BamHI
at the 3' end, which both leave "sticky ends".
V. Designing restriction enzyme cut sites into your primers (5 pts)
20. For each restriction enzyme below, write the recognition site in its double-stranded form, placing a slash sign (/) at the cut site on each strand. Label the 5’ and 3’ ends. You can find this
information by mousing over the enzyme name on the pFLAG-CMV-1 map.
The first of four strands is completed for you.
(3 points, one for each strand-plus-cut-site, including complementary strands
)
KpnI
: 5’GGTAC/C 3’
3’C/CATGG 5’ BamHI
: 5’ G/GATCC 3’
3’ CCTAG/G 5’
Now you will add the RE sequence to the 5' ends of each of your primers. However, for the enzymes to cut efficiently, you'll also need to add a couple more nucleotides to each end after that.
Let's use "CC", so each pair of primers will begin with CC.
21. Show the new primer sequences below, including the new cut sites. Be sure to include both the sense and anti-sense strand for each primer. Also, include the 5’ and 3’ labels to mark
the orientation.
(2 pts for each primer)
Forward primer: 5’ CCGGTAC/C
AGCAACCTCAAACAGACACCG/GATCC 3’
3’ GGCCATG/GTCGTTGGAGTTTGTCTGTGGC/CTAGG 5’
Reverse primer: 5’ CCGGTAC/CATTGGACAGCAAGAAAGCGAG/GATCC 3’
3’ GGCCATG/GTAACCTGTCGTTCTTTCGCTC/CTAGG 5’
A PCR reaction using these primers will result in millions of copies of the sequence, flanked by the enzyme sites. You
can
then cut the products with
KpnI
and
BamHI, leaving sticky ends-- this will be your 'insert'. At the same time, but in another tube, you
can
cut the plasmid vector with the same two enzymes.
Then you'll allow the insert to join up by its sticky ends to the matching sticky ends of the vector. Presto!
Now check your work by referring to the PCR primer guide pdf (linked in proj 6 module)
, and make any corrections needed!
VI. Mutation analysis (5 pts)
To see what mutation(s) the patient carries with respect to the normal allele, you'll align the
patient's genomic sequence (pt_HBB) with the sequence from NCBI, which you can assume represents the normal (wild-type) allele.
Compare the patient sequence to the HBB sequence you downloaded from NCBI, using the BLAST program "
Global Align
". Enter each sequence into a separate window, leaving
all settings at default. Use a FASTA heading for each so that you can readily distinguish
